ID: 990290593

View in Genome Browser
Species Human (GRCh38)
Location 5:54346761-54346783
Sequence CTGGACTTCTTGGGAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990290587_990290593 14 Left 990290587 5:54346724-54346746 CCAGCGTAATTAAAAGTGGTATT No data
Right 990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990290593 Original CRISPR CTGGACTTCTTGGGAAAAAC AGG Intergenic
No off target data available for this crispr