ID: 990293069

View in Genome Browser
Species Human (GRCh38)
Location 5:54374618-54374640
Sequence ACTTTAAAACAACTGTCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990293069_990293073 16 Left 990293069 5:54374618-54374640 CCTTAAGACAGTTGTTTTAAAGT No data
Right 990293073 5:54374657-54374679 TGCCATCAGGTCTTTTTTAGGGG No data
990293069_990293070 3 Left 990293069 5:54374618-54374640 CCTTAAGACAGTTGTTTTAAAGT No data
Right 990293070 5:54374644-54374666 CATTTAGTAAATCTGCCATCAGG No data
990293069_990293072 15 Left 990293069 5:54374618-54374640 CCTTAAGACAGTTGTTTTAAAGT No data
Right 990293072 5:54374656-54374678 CTGCCATCAGGTCTTTTTTAGGG No data
990293069_990293071 14 Left 990293069 5:54374618-54374640 CCTTAAGACAGTTGTTTTAAAGT No data
Right 990293071 5:54374655-54374677 TCTGCCATCAGGTCTTTTTTAGG No data
990293069_990293076 18 Left 990293069 5:54374618-54374640 CCTTAAGACAGTTGTTTTAAAGT No data
Right 990293076 5:54374659-54374681 CCATCAGGTCTTTTTTAGGGGGG No data
990293069_990293074 17 Left 990293069 5:54374618-54374640 CCTTAAGACAGTTGTTTTAAAGT No data
Right 990293074 5:54374658-54374680 GCCATCAGGTCTTTTTTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990293069 Original CRISPR ACTTTAAAACAACTGTCTTA AGG (reversed) Intergenic