ID: 990293070

View in Genome Browser
Species Human (GRCh38)
Location 5:54374644-54374666
Sequence CATTTAGTAAATCTGCCATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990293067_990293070 23 Left 990293067 5:54374598-54374620 CCTATTAGTCCTTTGAGCATCCT No data
Right 990293070 5:54374644-54374666 CATTTAGTAAATCTGCCATCAGG No data
990293066_990293070 29 Left 990293066 5:54374592-54374614 CCACATCCTATTAGTCCTTTGAG No data
Right 990293070 5:54374644-54374666 CATTTAGTAAATCTGCCATCAGG No data
990293069_990293070 3 Left 990293069 5:54374618-54374640 CCTTAAGACAGTTGTTTTAAAGT No data
Right 990293070 5:54374644-54374666 CATTTAGTAAATCTGCCATCAGG No data
990293068_990293070 14 Left 990293068 5:54374607-54374629 CCTTTGAGCATCCTTAAGACAGT No data
Right 990293070 5:54374644-54374666 CATTTAGTAAATCTGCCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990293070 Original CRISPR CATTTAGTAAATCTGCCATC AGG Intergenic