ID: 990293076

View in Genome Browser
Species Human (GRCh38)
Location 5:54374659-54374681
Sequence CCATCAGGTCTTTTTTAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990293069_990293076 18 Left 990293069 5:54374618-54374640 CCTTAAGACAGTTGTTTTAAAGT No data
Right 990293076 5:54374659-54374681 CCATCAGGTCTTTTTTAGGGGGG No data
990293068_990293076 29 Left 990293068 5:54374607-54374629 CCTTTGAGCATCCTTAAGACAGT No data
Right 990293076 5:54374659-54374681 CCATCAGGTCTTTTTTAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990293076 Original CRISPR CCATCAGGTCTTTTTTAGGG GGG Intergenic