ID: 990293076 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:54374659-54374681 |
Sequence | CCATCAGGTCTTTTTTAGGG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
990293069_990293076 | 18 | Left | 990293069 | 5:54374618-54374640 | CCTTAAGACAGTTGTTTTAAAGT | No data | ||
Right | 990293076 | 5:54374659-54374681 | CCATCAGGTCTTTTTTAGGGGGG | No data | ||||
990293068_990293076 | 29 | Left | 990293068 | 5:54374607-54374629 | CCTTTGAGCATCCTTAAGACAGT | No data | ||
Right | 990293076 | 5:54374659-54374681 | CCATCAGGTCTTTTTTAGGGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
990293076 | Original CRISPR | CCATCAGGTCTTTTTTAGGG GGG | Intergenic | ||