ID: 990295825

View in Genome Browser
Species Human (GRCh38)
Location 5:54400478-54400500
Sequence CAGGCTGTGGAGTTGGACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 333}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990295819_990295825 -2 Left 990295819 5:54400457-54400479 CCTGGTGGAGAGGGAAGACCACA 0: 1
1: 0
2: 3
3: 30
4: 272
Right 990295825 5:54400478-54400500 CAGGCTGTGGAGTTGGACCTGGG 0: 1
1: 0
2: 1
3: 33
4: 333
990295814_990295825 17 Left 990295814 5:54400438-54400460 CCTTAGTAATTGGTGGCAACCTG 0: 1
1: 0
2: 0
3: 6
4: 70
Right 990295825 5:54400478-54400500 CAGGCTGTGGAGTTGGACCTGGG 0: 1
1: 0
2: 1
3: 33
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990295825 Original CRISPR CAGGCTGTGGAGTTGGACCT GGG Intergenic
900516048 1:3082668-3082690 CAGGATCTGGAGCTGGACCTGGG + Intronic
900679030 1:3906087-3906109 CAGGATGTGGAGGTCTACCTAGG + Intergenic
900889674 1:5440670-5440692 CATGTTGTTGAGTTGGACATAGG + Intergenic
901135304 1:6989134-6989156 CAGGCTGTGGTGGTGGAGGTGGG - Intronic
902612512 1:17605467-17605489 AAAGCTGAGGAGTTGGCCCTCGG + Intronic
903017498 1:20370676-20370698 CAGGATTTGGAACTGGACCTGGG - Intergenic
904082282 1:27879805-27879827 GAGGCTGTGGTGATGCACCTCGG + Exonic
905389323 1:37626149-37626171 CAGGCTGAGGAGTTTGGACTTGG - Intronic
906520089 1:46461714-46461736 CAGGCTGTGGCCTTGGACCCGGG + Intergenic
907303127 1:53500573-53500595 CCGGCTCTGGGGTTGGACTTGGG - Intergenic
907476582 1:54709997-54710019 CAGGATGTGGTCCTGGACCTGGG - Exonic
908356671 1:63329723-63329745 AAGGCTGTGGACCTGGACCCTGG + Intergenic
910655701 1:89615994-89616016 CAGTCTGTGGACTGGTACCTGGG - Intergenic
913532512 1:119742894-119742916 CAGGCTGTGGGCTTGGTCCAAGG + Exonic
914886599 1:151590185-151590207 GAGGCTGTGGAGCTAGAACTAGG + Intergenic
915294622 1:154911299-154911321 AAGACAGTGGAGTTGGGCCTGGG - Intergenic
915419069 1:155765397-155765419 CATGCTGTGGAATTGGACACTGG - Exonic
915445980 1:155975320-155975342 CTGGCTGTGGAATTTGACCTTGG - Intronic
920308225 1:205032459-205032481 GAGGCTGAGTCGTTGGACCTGGG - Intergenic
920645795 1:207803561-207803583 CAGTCTTTGGAGTTAGACCTGGG - Intergenic
921485617 1:215712439-215712461 AAGGCTGGTGAGTTGGCCCTCGG + Intronic
921775766 1:219097657-219097679 TAGGCTTTGGACTTGGACTTTGG + Intergenic
922515007 1:226200941-226200963 CTGGATGTGGAGTAGGAGCTGGG - Intergenic
923522550 1:234746939-234746961 CAGGCTGTGCACTGTGACCTGGG - Intergenic
923758469 1:236816597-236816619 ATGGCTGTGGAGTGTGACCTGGG + Intronic
924236464 1:242003328-242003350 CTGGCAGTGGAGTGAGACCTAGG + Intergenic
1062823520 10:551797-551819 CAGGCTCTGGGGTTCAACCTCGG + Intronic
1063352646 10:5369554-5369576 CAGGCTTTGGAGTTAGACACAGG - Intronic
1063718167 10:8550811-8550833 GAGGCTTTTGAGTTAGACCTTGG - Intergenic
1064335541 10:14437336-14437358 AAGGCTGGGGAGTTTGGCCTAGG + Intronic
1065020144 10:21496344-21496366 CAGGCTGGGGAGCCGGAGCTCGG - Intronic
1065622660 10:27599545-27599567 CAGGATCTGTAGTTGGACCAAGG + Intergenic
1066098705 10:32097953-32097975 GAGGCTTTGGACTTGGACTTGGG - Intergenic
1066493509 10:35918166-35918188 CAGACAGTGGAGTTGGAGATAGG + Intergenic
1067432340 10:46252660-46252682 GAGGCTGTGGGGATGGACCCGGG - Intergenic
1067723469 10:48748407-48748429 CAGGCTTTGGAGGTAGCCCTGGG - Intronic
1068876634 10:62003672-62003694 CAGGCTGTGACTTTGGAGCTGGG + Intronic
1072748506 10:97959068-97959090 CAGCCTTTGCAGTTAGACCTGGG + Intronic
1073017851 10:100416042-100416064 CAGGCTCTGGAAGTGGATCTGGG + Intergenic
1073790079 10:106931055-106931077 CATGCTGTGGAGTTGAATCCTGG + Intronic
1075445420 10:122509580-122509602 CAGGCCGTGGTGAGGGACCTGGG + Intronic
1075545012 10:123348604-123348626 GAGGCTGTGGAGGCAGACCTGGG + Intergenic
1075585221 10:123652435-123652457 CAGGCTGGGGAACTGGAGCTGGG + Intergenic
1076754706 10:132563148-132563170 CAGGCTGTGGAGCTGGGCCCTGG + Intronic
1077458161 11:2693378-2693400 CAGTGTGTGGAGCTGGGCCTGGG + Intronic
1078064059 11:8066418-8066440 CAGGCTGTGGAGCTGTACAGGGG - Intronic
1078406686 11:11075977-11075999 CAGGCTCTGGAGCTGGAACTTGG + Intergenic
1078469422 11:11575241-11575263 CAGGCTCTGGAGTGGGACAAAGG - Intronic
1079184242 11:18221714-18221736 CAAGCTGTGGCTGTGGACCTGGG - Intronic
1079687446 11:23377507-23377529 CAGGCTGAGGTCTTGGAGCTGGG + Intergenic
1080113576 11:28596989-28597011 GAGGTTGTGGGGTTGGACATGGG + Intergenic
1082001765 11:47397080-47397102 GAGGCTGTGGAGTGGGGCCTTGG + Intergenic
1082056278 11:47819941-47819963 CAGGCTGCAGAGTTGGAGCAGGG - Intronic
1082096052 11:48130157-48130179 CAGGCTCTGGAGGAGAACCTTGG - Intronic
1083665049 11:64269643-64269665 CGTGCTGGGGACTTGGACCTGGG + Intergenic
1084069519 11:66725214-66725236 AAGGCTGTGGAGTTGCAACATGG - Intronic
1084154955 11:67308180-67308202 CAGGCTCTGGAGCTGCGCCTGGG + Exonic
1084195904 11:67523495-67523517 CAGGCGGGGGACTTGGGCCTGGG + Intergenic
1084384232 11:68832485-68832507 TAAGTTTTGGAGTTGGACCTGGG - Intronic
1085221122 11:74874442-74874464 CTGGCTGTTGAGCTGGTCCTCGG - Intronic
1087782718 11:102318339-102318361 CAGGCTTTGGAGTCAGACATCGG - Intronic
1088500461 11:110477756-110477778 CAGGTTGTGGAGATGGCCCTGGG - Intergenic
1091248506 11:134121125-134121147 CAGCCTGTTGAGTTAGAACTGGG + Intronic
1091815183 12:3432303-3432325 CAGCCTGTGGAGGTGAACCCAGG + Intronic
1092054232 12:5495840-5495862 AGGGCTTTGGAGTCGGACCTGGG + Intronic
1092236789 12:6815430-6815452 CAGGATCTGGGGTAGGACCTTGG - Intronic
1092287445 12:7136948-7136970 CAGGCTGTGCAGGTGCCCCTGGG + Exonic
1093153747 12:15655255-15655277 CAGGCTGGGGAGTGGTACATCGG - Intronic
1094128478 12:27049510-27049532 CAGGCTCTGGGTTTGAACCTTGG + Intronic
1094479527 12:30870603-30870625 CAGCCTGTGGAGATGAACCTAGG - Intergenic
1095791369 12:46170866-46170888 CAGGATTTGGAGTTGGACATAGG - Intergenic
1096565601 12:52475418-52475440 CAGCCTCTGGAGTAGGAGCTGGG - Intergenic
1100550078 12:95639053-95639075 CTGGCTAAGGAGTTGGAACTTGG - Intergenic
1101242192 12:102849586-102849608 CAGGCTCTGGACTTGGCCCAGGG - Intronic
1101882840 12:108637767-108637789 CAGGCTGTGGTGTTGCCTCTGGG - Intergenic
1102961817 12:117098465-117098487 CGGGCTGGGGACTTGGCCCTGGG - Intronic
1103655087 12:122464403-122464425 CAGGTTGTGGGATTGGACCTGGG - Intergenic
1103908032 12:124337163-124337185 GAGGAGGTGGAGGTGGACCTGGG + Exonic
1106027432 13:25968398-25968420 CGGGCTGTGGAGATGGAACCTGG + Intronic
1106072617 13:26426888-26426910 CAGGAAGTGGTGTTGGAGCTAGG - Intergenic
1111336126 13:86825997-86826019 CATGCTGAGGAGTGGGGCCTTGG + Intergenic
1111487881 13:88927266-88927288 CAGGTTGTGGAGCTGCAGCTGGG + Intergenic
1113170840 13:107501288-107501310 CACGCTGTGGTGTTGGAGGTGGG - Intronic
1113264983 13:108607164-108607186 AAGACTGTGGACTTGGACTTTGG + Intronic
1113651949 13:112039733-112039755 CAGGCTCTGGAGATGGAGCCGGG - Intergenic
1115979549 14:39035049-39035071 CAGAGTCTGGAGTTAGACCTTGG + Intronic
1117488493 14:56223103-56223125 CAGGCTGTAGAGGTGGACGGAGG - Intronic
1117547837 14:56808024-56808046 CGGGCAGTGGAGCGGGACCTCGG - Intronic
1118650976 14:67893988-67894010 CTGGCTTTGGAGTTAGACGTTGG + Intronic
1120519107 14:85505579-85505601 CAGGCTGTGGATTTTTACTTAGG + Intergenic
1121002855 14:90464642-90464664 CAGTCTGTGGTTTTGGACCCTGG + Intergenic
1122080093 14:99261083-99261105 CAGGCTGTGGCGCTGTGCCTTGG + Intronic
1122346137 14:101061718-101061740 CCGGCTCTGGAGGTGGACCTTGG + Intergenic
1123067096 14:105624226-105624248 CAGGCTGTGCAGGTGTGCCTGGG - Intergenic
1123071119 14:105642953-105642975 CAGGCTGTGCAGGTGTGCCTGGG - Intergenic
1123076078 14:105667995-105668017 CAGGCTGTGCAGGTGTGCCTGGG - Intergenic
1123090779 14:105741223-105741245 CAGGCTGTGCAGGTGTGCCTGGG - Intergenic
1123096414 14:105768987-105769009 CAGGCTGTGCAGGTGTGCCTGGG - Intergenic
1123611585 15:22099356-22099378 CCCGCTCTGGTGTTGGACCTGGG - Intergenic
1124620727 15:31272481-31272503 CAGGCTGAGGAGTTTGGACTTGG + Intergenic
1125478572 15:40064187-40064209 CTGGCTTTGAAGTTGGGCCTGGG - Intergenic
1126796045 15:52261264-52261286 CAGGAGGTGGAGATAGACCTGGG + Intronic
1127851837 15:62920219-62920241 CATGCTGTGGAGTTGTTGCTAGG + Intergenic
1128944594 15:71811988-71812010 CATGCTGTCCAGGTGGACCTGGG - Exonic
1129129866 15:73483972-73483994 GAGGCTGTGGAGTAGGCCCCAGG - Intronic
1129879978 15:78999947-78999969 CAGCCTGAGGAGTTGGGACTGGG - Intronic
1130650092 15:85757532-85757554 CAGAATGTGGATTTGGAGCTAGG - Intergenic
1131083272 15:89554607-89554629 GAGGCTGTGGAGGTGGACTGGGG - Intergenic
1132710514 16:1264193-1264215 GAGGCTGTAGGGTTGGGCCTCGG - Intergenic
1133164594 16:3937676-3937698 CAGGCTCTGGAGATGGAGCTGGG + Intergenic
1133225789 16:4339816-4339838 TGGGCTGAGGACTTGGACCTTGG - Intronic
1134047468 16:11111326-11111348 CTGGCTGTGGGCCTGGACCTTGG + Intronic
1134292959 16:12917923-12917945 AAGCCTGTGGAATTTGACCTAGG + Intronic
1136070856 16:27786214-27786236 GAGGCTGTGCAGTTAGGCCTGGG - Intergenic
1136416946 16:30109959-30109981 CAGGCTCTGGAGTCAGACCCAGG + Intronic
1136619997 16:31422313-31422335 CAGGCTGTGTGGTTGGCACTGGG - Intronic
1136737185 16:32475609-32475631 CAGGCTGGGGTGTTGGGCCCTGG - Intergenic
1138105933 16:54287100-54287122 CAGGCTGAGGCGCGGGACCTGGG + Intergenic
1138665854 16:58567751-58567773 CTGGCTGTGGAGCTGGAGATGGG - Intronic
1139614743 16:68082165-68082187 CAGGCTGAGGAGTTTGGACTTGG - Intergenic
1142126322 16:88412300-88412322 CAGGCTGTGGAGAGGGCACTGGG - Intergenic
1203015885 16_KI270728v1_random:353968-353990 CAGGCTGGGGTGTTGGGCCCTGG + Intergenic
1203034220 16_KI270728v1_random:627126-627148 CAGGCTGGGGTGTTGGGCCCTGG + Intergenic
1143356480 17:6332801-6332823 CAGGCTTGGGTGTTGGACCAAGG + Intergenic
1143572758 17:7770684-7770706 CAGGCTGCAGAGTGGGACCAAGG + Intronic
1144664582 17:17093289-17093311 CTGTCTGAGGAGTTTGACCTAGG + Intronic
1144783952 17:17821684-17821706 CAGGCTGCACAGTTGGTCCTTGG - Intronic
1145781543 17:27567000-27567022 CAGGGCCTGGATTTGGACCTTGG - Intronic
1147314617 17:39613698-39613720 CAGTCTGAGGAGGTGGACTTGGG + Intergenic
1147794182 17:43030906-43030928 CTGGATGTGGTGTTGGAGCTGGG + Intergenic
1148718750 17:49735071-49735093 CAGGTTGTGGAAATGGACCCTGG + Intronic
1149583810 17:57770838-57770860 GAGGCTGTGGAGTTTGATCAAGG + Intergenic
1150140339 17:62723140-62723162 CAGGCTGATGAGCTGGCCCTGGG - Intronic
1150629962 17:66873009-66873031 TAGACTTTGGAGTTAGACCTGGG + Intronic
1151015866 17:70552050-70552072 TAGGCTGTTAAGTTTGACCTGGG + Intergenic
1151114676 17:71722279-71722301 CAGGATTTGGATTTGCACCTTGG - Intergenic
1152805026 17:82351658-82351680 CCGGCCGTGGAGCTGGACCGAGG + Intergenic
1153275068 18:3360354-3360376 CAGGCTCTGGAGTGGGACAAAGG - Intergenic
1153291053 18:3501768-3501790 CAGCCTGGGGAGCTGGACATTGG + Intronic
1153850494 18:9089587-9089609 TCGACTGTGGAGTTGTACCTTGG - Intergenic
1154253218 18:12761618-12761640 CTGGCTGTGGAGACAGACCTAGG - Intergenic
1155262074 18:24052836-24052858 CAGGGCATGGAATTGGACCTGGG + Intronic
1155839448 18:30628606-30628628 CAGGCTGCAGGGCTGGACCTCGG + Intergenic
1156220523 18:35046547-35046569 CAGGCGGGGTAGTTGGAACTTGG + Intronic
1157485693 18:48085228-48085250 CAGGCTTTGGAGGTAGAGCTGGG + Intronic
1157568060 18:48693430-48693452 GAGTCTCTGGAGTGGGACCTGGG + Intronic
1160945964 19:1644256-1644278 CAGGCTGTGGCGCTGGCCCCAGG - Intronic
1161153965 19:2722773-2722795 CAGGCTGAGAAGCTGGACCTTGG - Intronic
1161191408 19:2959055-2959077 CAGACTGGGGAGTAGAACCTGGG - Intergenic
1161760116 19:6164881-6164903 CAGGCTCTGGAGTCAGACCTTGG + Intronic
1161992792 19:7694514-7694536 CAGGCTGTGGGGCTGGATTTCGG + Intronic
1163188655 19:15659027-15659049 TAGGCTGGGGGGTTGGAGCTCGG + Intronic
1163356779 19:16817851-16817873 GAGGCTGTGGAGATGGACACAGG - Exonic
1163376009 19:16931004-16931026 CAGGTTGGGGAGTTAGCCCTCGG - Intronic
1163869950 19:19812364-19812386 CAGGTTGTGGAGTTCCACCAGGG - Intronic
1166054815 19:40282107-40282129 CAGGCTGGGGAGCTGGATCCCGG + Intronic
1166315700 19:41988288-41988310 CAGGCTGTGGGCTGGGACCCTGG - Intronic
1166427002 19:42687968-42687990 CTGGCTGTTGAGTTGGTCCTCGG + Intronic
1166701675 19:44885918-44885940 CAGGCTGTGGGGTAGGAGGTAGG - Exonic
1166903706 19:46087698-46087720 CAGGCAGTGGAATTTGTCCTTGG + Intergenic
1167037163 19:47001318-47001340 AAGGCTGTGGAGTGGGACGGTGG - Exonic
1167483417 19:49746538-49746560 CAGGCTGGGGAATGGGGCCTCGG - Exonic
1168153735 19:54462204-54462226 CAGCTTGGGGAGGTGGACCTGGG + Exonic
1168469545 19:56629345-56629367 CAGGGTGTGGAGTTGGTCCTGGG - Intergenic
924963607 2:56893-56915 CAGCCTGGGGAGGTGGAGCTGGG + Intergenic
925141147 2:1550609-1550631 GAGGCTGTGAGGTTGGACCGAGG + Intergenic
926439781 2:12875622-12875644 CAGGCTGGGGGGTTGAAACTGGG + Intergenic
927823474 2:26289809-26289831 CAGGCTTTGGAGTGGGATCCTGG - Intronic
929662735 2:43805059-43805081 CAGGCTGAGGAATGGGAGCTTGG + Intronic
932347953 2:71007786-71007808 CAGGCAGAGGAGCTGGGCCTAGG + Intergenic
932485859 2:72083952-72083974 CAGGCTGCGGAGTGGGACTTGGG + Intergenic
932704176 2:74010346-74010368 CCGGATGTGGAGGAGGACCTGGG + Intronic
934582850 2:95459687-95459709 AAAGCTGAGCAGTTGGACCTGGG + Intergenic
934596600 2:95617027-95617049 AAAGCTGAGCAGTTGGACCTGGG - Intergenic
934780775 2:96968424-96968446 CAGGCTGTGGAGAGAGCCCTGGG + Intronic
934786168 2:97008536-97008558 AAAGCTGAGCAGTTGGACCTTGG + Intronic
936089028 2:109489089-109489111 CAGGCAGTGGAGTTGGAGGCTGG + Intronic
936174207 2:110204870-110204892 CAGGCTGTGCAGAGGGCCCTGGG - Intronic
936239374 2:110773744-110773766 AAGTCTGTGGAGCTGGAGCTGGG - Intronic
937227671 2:120379050-120379072 CAGGCCACGGAGTTGGAACTGGG - Intergenic
939582430 2:143966554-143966576 CAGGGTTTGGAGTAGAACCTGGG - Intronic
940230338 2:151444765-151444787 AAGACTTTGGAGTTGGCCCTGGG + Intronic
940855674 2:158726893-158726915 CAGGCTTAGGAGTTGGACCCAGG + Intergenic
942387813 2:175460711-175460733 CAGGCTGTGGCTTTGGAGATTGG + Intergenic
943042030 2:182814923-182814945 CAGCCTGTGGAGGTGCACCTTGG + Intergenic
943267592 2:185754767-185754789 CAGGCTCTGGAATTGGACTGTGG + Intronic
944227318 2:197360565-197360587 CAGGCTGTGGAGTCAGACACAGG + Intergenic
945317972 2:208391411-208391433 CTGGCTGTTGAGCTGGTCCTTGG + Intronic
946886627 2:224228275-224228297 CATGCTGTGGAATGGGATCTTGG - Intergenic
947230840 2:227884817-227884839 CTGGCTGTGGAGTGGGGTCTGGG + Intronic
948702460 2:239768794-239768816 CGGGCTGTGGAGTGGGGCCCAGG + Intronic
948725995 2:239934338-239934360 CAGGAGGTGGAGTGGGAACTAGG - Intronic
948927223 2:241107126-241107148 CAGGGTGTGGCTTTGGACCTTGG - Intronic
1168756556 20:322454-322476 CAGGCAGTGAACTTGGAACTGGG - Intergenic
1168767591 20:392278-392300 CAGGCTCTGGAGTCAGATCTAGG - Intronic
1170738074 20:19027849-19027871 GAGTCTGTGGTATTGGACCTTGG + Intergenic
1170802269 20:19600193-19600215 CAGGGTCTGGAGCTGGAGCTGGG - Intronic
1171253534 20:23668639-23668661 CAGGCTCTGAAGGTGGCCCTGGG + Intergenic
1171269083 20:23799465-23799487 CAGGCTCTGCAGGTGGCCCTGGG + Intergenic
1172996022 20:39071113-39071135 CAGGCTGTGTGGTTTGAGCTGGG - Intergenic
1173503665 20:43570866-43570888 AAGGCTGGGCACTTGGACCTCGG - Intronic
1173936632 20:46871587-46871609 AGGGATGTGGAATTGGACCTTGG + Intergenic
1174028440 20:47599858-47599880 CAGGAAGTGGAGATGGATCTGGG - Intronic
1174212796 20:48893071-48893093 CATGCTGTGAAGTTGAAGCTGGG - Intergenic
1174311472 20:49658727-49658749 CAGTCTGGGTAGTGGGACCTAGG - Intronic
1174387239 20:50194390-50194412 GAGGCTGAGGGGCTGGACCTAGG + Intergenic
1174550594 20:51358787-51358809 CAGGCTTTGGAGTCAGGCCTGGG + Intergenic
1174587173 20:51618376-51618398 CACACTGTGGGGTTGGATCTGGG - Intronic
1174671190 20:52309060-52309082 CAGGCTTTGGAGTGGGAGGTGGG + Intergenic
1175237342 20:57524300-57524322 CAGGCTTTGGAGTTGAAACAAGG + Intronic
1175949964 20:62578165-62578187 CAGGCTGTGGAGTTGGGGCCGGG - Intergenic
1176370842 21:6060626-6060648 CAGGCTGTGCAGTTGGCCTGGGG + Intergenic
1176676153 21:9779370-9779392 CAAGCTAGGGAGTTGGAACTGGG + Intergenic
1176973370 21:15290552-15290574 CAAGCTGTGGCTGTGGACCTTGG - Intergenic
1177519841 21:22205804-22205826 CAGGCTTTGGAGAGAGACCTTGG + Intergenic
1178731577 21:35107801-35107823 CAGGCTTTGGAGTCAGACCTAGG + Intronic
1179101047 21:38355801-38355823 CTGGCTGTGGAGCTGGAAGTGGG - Intergenic
1179540399 21:42079782-42079804 CAGGCTGGGGATGTGGACCGGGG + Intronic
1179752677 21:43477915-43477937 CAGGCTGTGCAGTTGGCCTGGGG - Intergenic
1179942896 21:44651027-44651049 CAGGCTCTGCAGTAGAACCTGGG + Intronic
1180076283 21:45464821-45464843 CAGGCTGTGGACCTGGAGATGGG - Intronic
1180802274 22:18637481-18637503 CAGGCTATGGAGGTAGACTTGGG - Intergenic
1181219451 22:21357778-21357800 CAGGCTATGGAGGTAGACTTGGG + Intergenic
1181582770 22:23837222-23837244 CAGGCTGTGGATGGGGGCCTGGG - Intronic
1181630887 22:24150752-24150774 CTGGGTTTGGAGTTAGACCTAGG + Intronic
1182129620 22:27841330-27841352 CAGGCTGGGCAGTGGGAACTGGG - Intergenic
1182159170 22:28104627-28104649 AAGGCTGCACAGTTGGACCTTGG - Intronic
1183248496 22:36711674-36711696 CAGGCTGGGGAGTGGATCCTGGG + Intergenic
1183411297 22:37656339-37656361 CAGGCTTTGGAGTCAGACCTAGG - Intronic
1183700429 22:39448132-39448154 CAGGCTGTCCAGCTGGACCTGGG - Intergenic
1183741137 22:39669256-39669278 AAGGCTCTGGAGCTGGACGTGGG + Intronic
1183991053 22:41597246-41597268 CAGGGTGTGGGGTAGGACCAGGG + Intergenic
950024083 3:9808979-9809001 CAGGCTTTGGAGTCAGACCTGGG + Intronic
952661544 3:35856178-35856200 GAGGTTGAGGTGTTGGACCTGGG + Intergenic
953136705 3:40188113-40188135 CAGGCAGTGGAAGTGGAACTGGG + Intronic
955050427 3:55405478-55405500 CAGGCTGAGGAATTGGGACTAGG + Intergenic
955325041 3:58003391-58003413 CAGCCTTTGGAGTTAGACCCAGG + Intergenic
955977752 3:64494385-64494407 CAGGCTGTAGAGATGGACCAGGG - Intergenic
957927415 3:86832595-86832617 CAGGCTGTGGATGGGGAGCTAGG - Intergenic
959892426 3:111571052-111571074 CAGGCTGTGGGGTAGGAGGTAGG + Intronic
961447700 3:126988569-126988591 CAGGCTGGGGCCTTGGGCCTCGG - Intergenic
961829575 3:129616530-129616552 CACGCTGGGGATTTGGGCCTTGG + Intergenic
962723932 3:138203522-138203544 CAGGCTGTGGAGCTGCCCCGTGG - Intronic
963066915 3:141271461-141271483 CAGATAGTGGAGCTGGACCTTGG + Intronic
963642876 3:147880372-147880394 CAGGCTGCTGGGCTGGACCTTGG + Intergenic
968796326 4:2707820-2707842 CAGGAGGTGGAATTGAACCTGGG - Intronic
968913320 4:3486501-3486523 CAGCATGTGGGGTGGGACCTGGG + Intronic
969717775 4:8876674-8876696 CAGACAGTGGAGATGGGCCTCGG - Intergenic
970167384 4:13253473-13253495 CAGGGGGAGGAGTAGGACCTAGG + Intergenic
974031635 4:56781560-56781582 CAGGATGTGGATCTGGATCTGGG + Intergenic
975204063 4:71624170-71624192 CAGGCTGTGGCGTTGGAGGATGG - Intergenic
975990548 4:80255690-80255712 AAGGCTTTGGAGTTTGACCATGG + Intergenic
980210880 4:129785855-129785877 CAGGCTCTGGAGATCGACCGTGG - Intergenic
983039394 4:162906935-162906957 GAGACTTTGGAGTTAGACCTGGG + Intergenic
984644184 4:182202623-182202645 GAAGCAGTGGAATTGGACCTGGG - Intronic
985399375 4:189579376-189579398 CAAGCTAGGGAGTTGGAACTGGG - Intergenic
988954734 5:36304032-36304054 CAGACTGTGCAGTTGGGGCTCGG - Intergenic
990295825 5:54400478-54400500 CAGGCTGTGGAGTTGGACCTGGG + Intergenic
991456041 5:66805765-66805787 CAGCCTGCGAAGCTGGACCTGGG + Intronic
993481058 5:88424976-88424998 CAGGCCTTGGACTTGGACCAAGG + Intergenic
995614851 5:113950367-113950389 CAGCCTGTGGAACAGGACCTAGG - Intergenic
995687907 5:114791208-114791230 CAGGCTGTGGAGATGGAGAGAGG - Intergenic
996549268 5:124712671-124712693 CACCCTGTGGAGTTGGCCCAGGG + Intronic
997399720 5:133592994-133593016 CTTGCTGTAGAGTTGCACCTTGG - Intronic
997452704 5:133996302-133996324 CAGGCTGTGGAGGGGAACCAGGG - Intronic
997572542 5:134942259-134942281 GAGGCTTTGGAGCTGGACATAGG + Intronic
998024583 5:138804232-138804254 CAGGCTCTGGAGCTGGATATAGG - Intronic
998315916 5:141183025-141183047 CATGCTTTGGACTTGGACGTAGG + Exonic
998483479 5:142482099-142482121 CAGGCTTTGGAATCCGACCTGGG + Intergenic
998806102 5:145919135-145919157 GAGGATTTGGAGTGGGACCTGGG - Intergenic
1000113427 5:158131423-158131445 CTGGCTGAGGAGTTGAAACTTGG - Intergenic
1000251381 5:159498855-159498877 CAGGCTGCAGAGCTGGACATTGG + Intergenic
1001300143 5:170527578-170527600 CAGGCAGTTGAGTTTGACATTGG + Intronic
1001656701 5:173356235-173356257 CAGGAGGTGGAGTTGGAGATGGG + Intergenic
1002023787 5:176383352-176383374 CAGGGTATGGAGTGGGCCCTGGG - Intronic
1002064921 5:176647259-176647281 CAGGCTGTGGGGGCGGAGCTCGG + Intergenic
1002194545 5:177494949-177494971 CCAGCCCTGGAGTTGGACCTGGG - Intronic
1003334613 6:5158981-5159003 CAGGTTCTGAAGGTGGACCTCGG + Intronic
1004151189 6:13121302-13121324 CAGGATTGGGAGTTGGACCCAGG - Intronic
1006389871 6:33751924-33751946 CAGGCTGGGGACTTGGCACTGGG + Intergenic
1006909239 6:37553184-37553206 AAGGCTGTGGGGTAGGAGCTGGG + Intergenic
1007166192 6:39830641-39830663 CAGGATGTGGCGTGGGACCCAGG + Intronic
1007455679 6:41975379-41975401 GAGGCTGAGGAGGTGGGCCTGGG - Intronic
1007528708 6:42521248-42521270 GTGGCTGTAGAGTGGGACCTTGG + Intergenic
1009266703 6:61564681-61564703 GAGGCTGTGGAGCTGGAGATAGG + Intergenic
1011351880 6:86432748-86432770 CAGCCTGTGGAGGATGACCTGGG - Intergenic
1012122285 6:95384024-95384046 CAAGCTGTGGCTGTGGACCTGGG + Intergenic
1012474512 6:99605016-99605038 CAGGCCCTGGAGTTGGCCCGAGG + Intergenic
1013734379 6:113208348-113208370 CAGGCTGTGGTGTAATACCTTGG - Intergenic
1013752094 6:113418791-113418813 CAGGTTTTTGAGTTAGACCTGGG - Intergenic
1014957617 6:127640581-127640603 CAGGTTGTGGAATGGGAGCTGGG - Intergenic
1018212658 6:161497089-161497111 CAGGCTGTGGAGTCGTAGCCAGG - Intronic
1019048153 6:169163536-169163558 CTGGCTGGGGAGTGGGAACTGGG + Intergenic
1022309315 7:29180754-29180776 CAGGCTCTGGAGTTAGAGCTGGG + Intronic
1022502202 7:30888845-30888867 CAGGCTGTTGAGTTTGAGCTTGG - Intronic
1022794309 7:33719757-33719779 CAGGGTGTGCACTGGGACCTTGG - Intergenic
1023285967 7:38620163-38620185 CAGGCAGTGGTCTTGGACTTAGG - Intronic
1028249357 7:88522781-88522803 CAGGCTGTGGAGAAGGAGCAGGG + Intergenic
1028609762 7:92697558-92697580 CAGACTCTGGAGTTAGACCTGGG - Intronic
1029420901 7:100471369-100471391 GTGGCTTTGGAGTTGGACCCAGG + Intronic
1030524652 7:110638586-110638608 CATGCGGTAGAGTTGGACTTGGG - Intergenic
1030719317 7:112850507-112850529 CTGGCTGTGAACTTGGTCCTTGG + Intronic
1030804608 7:113899738-113899760 CAGTCTTTGTAGTTGGATCTGGG + Intronic
1030957552 7:115873584-115873606 CAAGCTCTGGAATTGTACCTTGG - Intergenic
1031147872 7:118017018-118017040 CAGGCTCTGGAGTTGTACTGAGG - Intergenic
1032262173 7:130346731-130346753 GAGGCTGTGGAGCTGGAAGTGGG - Intronic
1032964917 7:137085177-137085199 CCAGCTCTGGAGTTGGAACTTGG + Intergenic
1033618556 7:143041004-143041026 GGGGCTTTGGAGTTCGACCTGGG - Intergenic
1033653028 7:143356291-143356313 GTGGCTGTGGAGAAGGACCTGGG - Exonic
1034252640 7:149704767-149704789 TTGGCTGTGGAGATGGGCCTTGG - Intergenic
1037403255 8:18515195-18515217 GTGGCTGTGGAGTTGGACTCTGG + Intergenic
1039788427 8:40854664-40854686 CAGGCTGTGGGCTGAGACCTTGG - Intronic
1044595611 8:93955661-93955683 CAGGTTGGGGAGCTGGACATGGG - Intergenic
1046967506 8:120183920-120183942 CAGGCTCTGGAGTTAGTTCTGGG + Intronic
1047054991 8:121153833-121153855 GAGACTGTGGAGTAGGAACTTGG + Intergenic
1047337215 8:123947845-123947867 GAGGCAGTTGAGTTGGGCCTAGG + Intronic
1047971021 8:130084621-130084643 CAGGCCTTGGAGTTGGAAATGGG + Intronic
1048877701 8:138850132-138850154 CAGGTGGTGGAGGTGGAACTGGG - Intronic
1050023074 9:1305148-1305170 CAGGCCCTGGAGGTGGACCGAGG + Intergenic
1051653758 9:19357133-19357155 CAGGCTCTGCAGTTGAACCAAGG + Exonic
1052308194 9:27034885-27034907 CAGGCTGTGCTGTTTGATCTTGG + Intronic
1052439773 9:28481096-28481118 CAGGCTTTGGAGTTAGAAATGGG - Intronic
1052801393 9:32971351-32971373 CAGGCTCTGGATTCAGACCTGGG - Intergenic
1053576575 9:39360926-39360948 CATGCTCTGGAGATGGCCCTGGG - Exonic
1053841085 9:42188851-42188873 CATGCTCTGGAGATGGCCCTGGG - Exonic
1054098142 9:60919617-60919639 CATGCTCTGGAGATGGCCCTGGG - Intergenic
1054119543 9:61195247-61195269 CATGCTCTGGAGATGGCCCTGGG - Exonic
1054588210 9:66987315-66987337 CATGCTCTGGAGATGGCCCTGGG + Intergenic
1055986235 9:82058509-82058531 CATGCTCTGGAGATGGCCCTGGG + Intergenic
1056611773 9:88130316-88130338 CATGCTCTGGAGATGGCCCTGGG + Intergenic
1057212950 9:93210404-93210426 CAGGCTGTGGAGTTGGGTCAGGG + Intronic
1057715538 9:97492367-97492389 AAGGCTGTGGTGTGGGATCTTGG - Intronic
1059080934 9:111249322-111249344 CAGGCTGTGGTCCTCGACCTTGG - Intergenic
1060218058 9:121750350-121750372 CAGGCAGTGCAGTGGGCCCTGGG - Intronic
1060374828 9:123108543-123108565 CAGGTTGTTGAGGTGGAACTGGG - Intergenic
1060508818 9:124217558-124217580 CTAGCTGTGGAGTCAGACCTGGG - Intergenic
1060962580 9:127691515-127691537 CAGGCTGTGGAGGAGGACGCTGG - Exonic
1061113664 9:128593990-128594012 CAGGCTGTGGCGTGGGTACTTGG + Intronic
1061260971 9:129480975-129480997 CTGCCTGTGGGGTGGGACCTGGG + Intergenic
1061560317 9:131398049-131398071 CTGGCTGTGGTGTTGGAGATGGG + Intronic
1061963476 9:133999852-133999874 CAGCGTGTGGAGGTGGACTTGGG + Intergenic
1062609357 9:137367052-137367074 CTGGCTGTGGCGCTGGGCCTTGG + Intronic
1062721588 9:138047063-138047085 CAGGCTGTGGCGGGGGAGCTGGG + Intronic
1185764046 X:2710144-2710166 CAGGGTGTGGGGTGGAACCTGGG + Intronic
1186515255 X:10161916-10161938 CAGGCTGTTGGAATGGACCTCGG - Intronic
1187091558 X:16102139-16102161 CAGGGTGTGGAGTTAGACCCTGG - Intergenic
1187969518 X:24645992-24646014 TTGGCTGTGGAGTTTGACCCTGG - Intronic
1189871902 X:45393239-45393261 GAGACTTTGGACTTGGACCTGGG - Intergenic
1190325839 X:49206486-49206508 GAGGCTGTGGAGGTGGTGCTGGG - Intronic
1192509367 X:71712829-71712851 AAGGCTGTGGAGTGGGACGAAGG - Intergenic
1192511362 X:71722336-71722358 AAGGCTGTGGAGTGGGACGAAGG + Intergenic
1192515335 X:71759169-71759191 AAGGCTGTGGAGTGGGACGAAGG - Intergenic
1192517330 X:71768724-71768746 AAGGCTGTGGAGTGGGACGAAGG + Intergenic
1193352539 X:80479493-80479515 CTGGCTGTTGAGCTGGTCCTTGG - Intergenic
1194019418 X:88668594-88668616 GAGACTTTGGAGTTGGACTTAGG - Intergenic
1195685246 X:107579141-107579163 CAGGCTGTGGCTTTGGACCCTGG - Intronic
1196124985 X:112087661-112087683 TAGGCTTTGGAGTCAGACCTGGG + Intergenic
1196711601 X:118769334-118769356 CAGGCTTTGGAATTGGACAGTGG + Intronic
1197355723 X:125435986-125436008 CTGGCTGTTGAGCTGGACCTTGG + Intergenic
1197771468 X:130092194-130092216 CAGGCAGTGGAGTAGGAGATAGG + Intronic
1197818643 X:130524113-130524135 CTGGCTCTGGAGCTGTACCTCGG - Intergenic
1198273598 X:135079740-135079762 CAGGCTTTGGATTTGAACCCAGG - Intergenic
1198601370 X:138287538-138287560 CAGGCTGAGAAGTTGCACTTTGG + Intergenic
1200345124 X:155440146-155440168 CAGGCAGTGGAATTTGTCCTTGG - Intergenic
1201391176 Y:13499022-13499044 AAGACTGTGGACTTGGACATAGG + Intergenic
1201683662 Y:16677836-16677858 CAGGGTGTGGAGTGGGAAATCGG + Intergenic
1202346541 Y:23934253-23934275 CCTGATGTGGAGGTGGACCTAGG - Intergenic
1202524230 Y:25735840-25735862 CCTGATGTGGAGGTGGACCTAGG + Intergenic