ID: 990304112

View in Genome Browser
Species Human (GRCh38)
Location 5:54478149-54478171
Sequence CAGGCTAAGGAATCTGGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990304112_990304118 11 Left 990304112 5:54478149-54478171 CCACTCCCAGATTCCTTAGCCTG No data
Right 990304118 5:54478183-54478205 ACACATTCTTCTTAGACCATAGG 0: 19
1: 33
2: 34
3: 40
4: 170
990304112_990304121 24 Left 990304112 5:54478149-54478171 CCACTCCCAGATTCCTTAGCCTG No data
Right 990304121 5:54478196-54478218 AGACCATAGGGCCATTTTCAGGG No data
990304112_990304119 12 Left 990304112 5:54478149-54478171 CCACTCCCAGATTCCTTAGCCTG No data
Right 990304119 5:54478184-54478206 CACATTCTTCTTAGACCATAGGG 0: 16
1: 32
2: 38
3: 44
4: 142
990304112_990304120 23 Left 990304112 5:54478149-54478171 CCACTCCCAGATTCCTTAGCCTG No data
Right 990304120 5:54478195-54478217 TAGACCATAGGGCCATTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990304112 Original CRISPR CAGGCTAAGGAATCTGGGAG TGG (reversed) Intergenic
No off target data available for this crispr