ID: 990306075 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:54495026-54495048 |
Sequence | CTTTCTCAACAGATGGAGTA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
990306068_990306075 | 22 | Left | 990306068 | 5:54494981-54495003 | CCCAGCAAGAATGTATAGGGCTG | No data | ||
Right | 990306075 | 5:54495026-54495048 | CTTTCTCAACAGATGGAGTAGGG | No data | ||||
990306069_990306075 | 21 | Left | 990306069 | 5:54494982-54495004 | CCAGCAAGAATGTATAGGGCTGT | No data | ||
Right | 990306075 | 5:54495026-54495048 | CTTTCTCAACAGATGGAGTAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
990306075 | Original CRISPR | CTTTCTCAACAGATGGAGTA GGG | Intergenic | ||
No off target data available for this crispr |