ID: 990306075

View in Genome Browser
Species Human (GRCh38)
Location 5:54495026-54495048
Sequence CTTTCTCAACAGATGGAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990306068_990306075 22 Left 990306068 5:54494981-54495003 CCCAGCAAGAATGTATAGGGCTG No data
Right 990306075 5:54495026-54495048 CTTTCTCAACAGATGGAGTAGGG No data
990306069_990306075 21 Left 990306069 5:54494982-54495004 CCAGCAAGAATGTATAGGGCTGT No data
Right 990306075 5:54495026-54495048 CTTTCTCAACAGATGGAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990306075 Original CRISPR CTTTCTCAACAGATGGAGTA GGG Intergenic
No off target data available for this crispr