ID: 990308515

View in Genome Browser
Species Human (GRCh38)
Location 5:54517255-54517277
Sequence GATTGGCAAGAACAAAGTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990308515_990308519 0 Left 990308515 5:54517255-54517277 CCCTTACTTTGTTCTTGCCAATC No data
Right 990308519 5:54517278-54517300 TCCTCTCCTTGAGCAGAAGAGGG No data
990308515_990308521 4 Left 990308515 5:54517255-54517277 CCCTTACTTTGTTCTTGCCAATC No data
Right 990308521 5:54517282-54517304 CTCCTTGAGCAGAAGAGGGAAGG No data
990308515_990308522 5 Left 990308515 5:54517255-54517277 CCCTTACTTTGTTCTTGCCAATC No data
Right 990308522 5:54517283-54517305 TCCTTGAGCAGAAGAGGGAAGGG No data
990308515_990308518 -1 Left 990308515 5:54517255-54517277 CCCTTACTTTGTTCTTGCCAATC No data
Right 990308518 5:54517277-54517299 CTCCTCTCCTTGAGCAGAAGAGG No data
990308515_990308524 20 Left 990308515 5:54517255-54517277 CCCTTACTTTGTTCTTGCCAATC No data
Right 990308524 5:54517298-54517320 GGGAAGGGAGCCTGCTCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990308515 Original CRISPR GATTGGCAAGAACAAAGTAA GGG (reversed) Intergenic
No off target data available for this crispr