ID: 990308519

View in Genome Browser
Species Human (GRCh38)
Location 5:54517278-54517300
Sequence TCCTCTCCTTGAGCAGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990308512_990308519 10 Left 990308512 5:54517245-54517267 CCTTCCCTGGCCCTTACTTTGTT No data
Right 990308519 5:54517278-54517300 TCCTCTCCTTGAGCAGAAGAGGG No data
990308516_990308519 -1 Left 990308516 5:54517256-54517278 CCTTACTTTGTTCTTGCCAATCT No data
Right 990308519 5:54517278-54517300 TCCTCTCCTTGAGCAGAAGAGGG No data
990308515_990308519 0 Left 990308515 5:54517255-54517277 CCCTTACTTTGTTCTTGCCAATC No data
Right 990308519 5:54517278-54517300 TCCTCTCCTTGAGCAGAAGAGGG No data
990308513_990308519 6 Left 990308513 5:54517249-54517271 CCCTGGCCCTTACTTTGTTCTTG No data
Right 990308519 5:54517278-54517300 TCCTCTCCTTGAGCAGAAGAGGG No data
990308514_990308519 5 Left 990308514 5:54517250-54517272 CCTGGCCCTTACTTTGTTCTTGC No data
Right 990308519 5:54517278-54517300 TCCTCTCCTTGAGCAGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990308519 Original CRISPR TCCTCTCCTTGAGCAGAAGA GGG Intergenic
No off target data available for this crispr