ID: 990308621

View in Genome Browser
Species Human (GRCh38)
Location 5:54517865-54517887
Sequence CCGCGGTACTGCTCGAGCCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 171}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990308621_990308633 3 Left 990308621 5:54517865-54517887 CCAGGGCTCGAGCAGTACCGCGG 0: 1
1: 0
2: 0
3: 10
4: 171
Right 990308633 5:54517891-54517913 CCTCAGGTGGGCCTCGGCTCGGG 0: 1
1: 0
2: 2
3: 14
4: 188
990308621_990308634 10 Left 990308621 5:54517865-54517887 CCAGGGCTCGAGCAGTACCGCGG 0: 1
1: 0
2: 0
3: 10
4: 171
Right 990308634 5:54517898-54517920 TGGGCCTCGGCTCGGGACGCCGG 0: 1
1: 0
2: 0
3: 7
4: 119
990308621_990308626 -9 Left 990308621 5:54517865-54517887 CCAGGGCTCGAGCAGTACCGCGG 0: 1
1: 0
2: 0
3: 10
4: 171
Right 990308626 5:54517879-54517901 GTACCGCGGGCCCCTCAGGTGGG 0: 1
1: 0
2: 0
3: 0
4: 45
990308621_990308631 2 Left 990308621 5:54517865-54517887 CCAGGGCTCGAGCAGTACCGCGG 0: 1
1: 0
2: 0
3: 10
4: 171
Right 990308631 5:54517890-54517912 CCCTCAGGTGGGCCTCGGCTCGG 0: 1
1: 0
2: 2
3: 20
4: 193
990308621_990308625 -10 Left 990308621 5:54517865-54517887 CCAGGGCTCGAGCAGTACCGCGG 0: 1
1: 0
2: 0
3: 10
4: 171
Right 990308625 5:54517878-54517900 AGTACCGCGGGCCCCTCAGGTGG 0: 1
1: 0
2: 0
3: 3
4: 44
990308621_990308628 -3 Left 990308621 5:54517865-54517887 CCAGGGCTCGAGCAGTACCGCGG 0: 1
1: 0
2: 0
3: 10
4: 171
Right 990308628 5:54517885-54517907 CGGGCCCCTCAGGTGGGCCTCGG 0: 1
1: 0
2: 0
3: 20
4: 221
990308621_990308637 17 Left 990308621 5:54517865-54517887 CCAGGGCTCGAGCAGTACCGCGG 0: 1
1: 0
2: 0
3: 10
4: 171
Right 990308637 5:54517905-54517927 CGGCTCGGGACGCCGGGAGTCGG 0: 1
1: 0
2: 2
3: 7
4: 74
990308621_990308638 18 Left 990308621 5:54517865-54517887 CCAGGGCTCGAGCAGTACCGCGG 0: 1
1: 0
2: 0
3: 10
4: 171
Right 990308638 5:54517906-54517928 GGCTCGGGACGCCGGGAGTCGGG 0: 1
1: 0
2: 0
3: 13
4: 118
990308621_990308640 30 Left 990308621 5:54517865-54517887 CCAGGGCTCGAGCAGTACCGCGG 0: 1
1: 0
2: 0
3: 10
4: 171
Right 990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG 0: 1
1: 0
2: 0
3: 0
4: 33
990308621_990308635 11 Left 990308621 5:54517865-54517887 CCAGGGCTCGAGCAGTACCGCGG 0: 1
1: 0
2: 0
3: 10
4: 171
Right 990308635 5:54517899-54517921 GGGCCTCGGCTCGGGACGCCGGG 0: 1
1: 0
2: 1
3: 21
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990308621 Original CRISPR CCGCGGTACTGCTCGAGCCC TGG (reversed) Exonic
904098413 1:28000833-28000855 CAGGTGGACTGCTCGAGCCCAGG + Intronic
904545478 1:31267573-31267595 CCGTTGCACTGCTCCAGCCCGGG - Intronic
906194631 1:43922136-43922158 CAGGGGTATTGCTTGAGCCCAGG + Intronic
908361619 1:63373847-63373869 CAGGAGTATTGCTCGAGCCCAGG - Intronic
908367569 1:63441994-63442016 CAGAGGGACTGCTTGAGCCCAGG + Intronic
908545756 1:65160685-65160707 CAGGAGTACTGCTTGAGCCCAGG - Intronic
908718313 1:67094860-67094882 CAGGGGAACTGCTTGAGCCCAGG - Intronic
910196608 1:84647816-84647838 CAGCCGAACTGCTTGAGCCCAGG + Intronic
910586295 1:88883568-88883590 CCAGGGTCCTGCTTGAGCCCAGG + Intronic
910910218 1:92225332-92225354 CCAGTGTACTGCTGGAGCCCAGG - Intronic
910933463 1:92465333-92465355 CAGGGGGACTGCTTGAGCCCAGG + Intergenic
912377830 1:109226584-109226606 CGGGGGGACTGCTTGAGCCCAGG - Intronic
914199756 1:145474403-145474425 CCGCGGAGCTGCTTGAGCCCAGG + Intergenic
914313176 1:146485655-146485677 CCTCGGAGCTGCTTGAGCCCAGG + Intergenic
914478874 1:148047538-148047560 CCGCGGAGCTGCTTGAGCCCAGG + Intergenic
914501174 1:148247726-148247748 CCTCGGAGCTGCTTGAGCCCAGG - Intergenic
917315234 1:173718153-173718175 CAGGGGGACTGCTTGAGCCCAGG - Intronic
917438638 1:175045768-175045790 CCGCGGCACTGGCGGAGCCCGGG - Intergenic
917574216 1:176303932-176303954 AGGAGGAACTGCTCGAGCCCAGG + Intergenic
917760738 1:178154374-178154396 CCGGAGGACTGCTTGAGCCCGGG - Intronic
1068563419 10:58543600-58543622 CAGGAGTACTGCTTGAGCCCAGG - Intronic
1074503465 10:114045454-114045476 CCGCGCGCCTGCTGGAGCCCTGG + Exonic
1074560798 10:114533767-114533789 CAGGGGGACTGCTAGAGCCCAGG - Intronic
1077802342 11:5552523-5552545 ACGTGGTACTGCTCAAGTCCAGG + Intronic
1081870830 11:46381846-46381868 CCGGGGGACGCCTCGAGCCCAGG - Intronic
1081897561 11:46599610-46599632 CCACTGTACTGCTCTAGCCTTGG + Intergenic
1083204711 11:61141438-61141460 CCAGGGTTCTGCTCCAGCCCAGG - Intronic
1083438794 11:62662432-62662454 CCGGGGTATTGCTTGAGGCCAGG - Intronic
1083457764 11:62790487-62790509 CAGGAGCACTGCTCGAGCCCAGG - Exonic
1085086448 11:73671110-73671132 CAGGTGTACTGCTTGAGCCCAGG + Intergenic
1085211692 11:74786323-74786345 CAGAAGGACTGCTCGAGCCCAGG - Intronic
1086768631 11:90731786-90731808 CAGGGGCATTGCTCGAGCCCAGG + Intergenic
1089456499 11:118628699-118628721 CAGCTGGCCTGCTCGAGCCCTGG - Intronic
1094189822 12:27686807-27686829 CCGGGGGACTGCTTGAGCCTAGG + Intronic
1097936239 12:65255176-65255198 CCGGAGGACTGCTTGAGCCCAGG + Intergenic
1100620235 12:96264210-96264232 CAGGAGGACTGCTCGAGCCCAGG - Intronic
1103333550 12:120171952-120171974 CAGCGGGATTGCTTGAGCCCAGG - Intronic
1103642797 12:122365778-122365800 CAGGAGAACTGCTCGAGCCCAGG + Intronic
1104929753 12:132332341-132332363 CCGGTGGATTGCTCGAGCCCAGG + Intergenic
1106010631 13:25817906-25817928 CAGCAGGACTGCTTGAGCCCAGG - Intronic
1108613299 13:52105674-52105696 CTGCAGTACTGCCTGAGCCCTGG - Intronic
1109277318 13:60317162-60317184 CAGGAGTACTGCTTGAGCCCAGG + Intergenic
1110313823 13:74082098-74082120 CAGGAGGACTGCTCGAGCCCAGG + Intronic
1110784308 13:79505400-79505422 CAGGGGTATTGCTTGAGCCCAGG + Intronic
1111251986 13:85613434-85613456 CAGGGGTACTGCTTGAGCCCAGG + Intergenic
1111913694 13:94339155-94339177 CCGGAGGACTGCTTGAGCCCAGG - Intronic
1113467752 13:110524179-110524201 CCGTGGAACTGCTCCCGCCCTGG + Exonic
1116878172 14:50135231-50135253 CCGGGGGACTGCTTAAGCCCAGG + Intronic
1117978181 14:61318918-61318940 CAGGAGTACTGCTTGAGCCCAGG - Intronic
1121111883 14:91318190-91318212 CCGAAGGACTGCTTGAGCCCAGG + Intronic
1122561282 14:102616496-102616518 CCGGAGGACTGCTTGAGCCCAGG - Intronic
1126000131 15:44201482-44201504 CCGCTGGACTGCTTGAGACCAGG + Intergenic
1126474532 15:49051899-49051921 CCAAGGTACAGCTCGAGCCATGG - Intergenic
1126832552 15:52623064-52623086 CAGCAGGACTGCTTGAGCCCAGG + Intronic
1127921141 15:63495004-63495026 CAGGAGTACTGCTTGAGCCCAGG + Intergenic
1128302549 15:66575676-66575698 TCGGGGGATTGCTCGAGCCCGGG - Intergenic
1129002691 15:72347362-72347384 TTGGGGTACTGCTTGAGCCCAGG - Intronic
1129433072 15:75515538-75515560 AGGCGGTACTGCTTGAGCCCAGG + Intronic
1132749756 16:1452099-1452121 CCCCTGTGCTGCTGGAGCCCAGG - Intronic
1133929662 16:10222000-10222022 CCGGAGGACTGCTAGAGCCCAGG - Intergenic
1134080899 16:11324297-11324319 TGGGGGTACTGCTTGAGCCCAGG - Intronic
1134087590 16:11368872-11368894 CAGAAGGACTGCTCGAGCCCAGG + Intronic
1134765281 16:16752050-16752072 CAGCGGGATTGCTTGAGCCCAGG - Intergenic
1136127915 16:28198574-28198596 CAGGAGGACTGCTCGAGCCCAGG + Intronic
1137634020 16:49969943-49969965 TCGCGCTACTGATCGTGCCCAGG - Intergenic
1138467867 16:57206311-57206333 CCGGAGTACTGCTAGAGTCCAGG + Intronic
1138476829 16:57275886-57275908 CAGGAGTACTGCTTGAGCCCAGG + Intronic
1141111939 16:81276972-81276994 CAGGGGAACTGCTCGAACCCGGG + Intronic
1145741378 17:27277639-27277661 AGGCAGGACTGCTCGAGCCCAGG - Intergenic
1146800513 17:35816052-35816074 CAGGAGTACTGCTTGAGCCCAGG - Intronic
1146973486 17:37091801-37091823 CAGGGGAACTGCTTGAGCCCAGG - Intronic
1147679464 17:42231567-42231589 CAGGTGTACTGCTTGAGCCCAGG - Intronic
1148494846 17:48047688-48047710 CCGCGGTACTGCTCCAGCGAAGG + Intergenic
1150043480 17:61888141-61888163 CAGGAGGACTGCTCGAGCCCAGG + Intronic
1151858628 17:76741539-76741561 CCGAGGTATTGCTTGAGCCAAGG + Intronic
1152093978 17:78262529-78262551 CCGGAGGACTGCTTGAGCCCAGG - Intergenic
1152762023 17:82113703-82113725 CGGCAGGACTGCTTGAGCCCAGG + Intronic
1155146900 18:23091843-23091865 CAGGGGTATTGCTTGAGCCCAGG + Intergenic
1155194058 18:23456157-23456179 GTGGGGTACTGCTTGAGCCCAGG - Intronic
1157249876 18:46085534-46085556 CTGCAGGACTGCTTGAGCCCAGG + Intronic
1157673247 18:49548712-49548734 CAGGAGAACTGCTCGAGCCCAGG + Intergenic
1157876807 18:51281399-51281421 CAGGGGTATTGCTTGAGCCCAGG - Intergenic
1159044060 18:63352009-63352031 CAGGAGTACTGCTGGAGCCCAGG - Intronic
1160706210 19:531476-531498 CCGCGGTGCTGGTCGAGCAGGGG + Intergenic
1161922399 19:7276371-7276393 ACGCAGGACTGCTTGAGCCCAGG - Intronic
1165205139 19:34177658-34177680 CCGGGGTATTGCTTGAGCCCAGG + Intronic
1165808888 19:38598557-38598579 CAGTAGTACTGCTTGAGCCCAGG - Intronic
1165957899 19:39513455-39513477 CAGGGGGACTGCTTGAGCCCAGG - Intergenic
928194665 2:29206497-29206519 CTGGAGGACTGCTCGAGCCCAGG - Intronic
935295706 2:101647486-101647508 CGGCAGGACTGCTTGAGCCCAGG + Intergenic
938661156 2:133488603-133488625 CAGGAGGACTGCTCGAGCCCAGG + Intronic
939207420 2:139125269-139125291 CAGGGGGACTGCTTGAGCCCAGG + Intergenic
940262151 2:151792213-151792235 CCGGAGGACTGCTTGAGCCCAGG - Intronic
941874896 2:170422293-170422315 CAGGGGGACTGCTTGAGCCCAGG - Intronic
945634722 2:212333449-212333471 CAGGAGAACTGCTCGAGCCCAGG + Intronic
1172923324 20:38506519-38506541 CAGGAGGACTGCTCGAGCCCAGG - Intronic
1175429312 20:58891107-58891129 CCGGGCTGCTGCCCGAGCCCGGG + Intronic
1176428649 21:6563394-6563416 CCGCAGGACTGCTCTAGCCCAGG - Intergenic
1176654981 21:9579908-9579930 CCGCGGTGCTGCTGGAGACGCGG + Intergenic
1178069790 21:28951742-28951764 CAGCAGGACTGCTTGAGCCCAGG + Intronic
1178868041 21:36346579-36346601 CCGGGGGATTGCTTGAGCCCAGG + Intronic
1178969185 21:37156127-37156149 TGGGGGTACTGCTTGAGCCCAGG - Intronic
1179060925 21:37978607-37978629 CAGGAGGACTGCTCGAGCCCAGG - Intronic
1179704139 21:43171710-43171732 CCGCAGGACTGCTCTAGCCCAGG - Intronic
1180087831 21:45516005-45516027 CCGCGGCACTCCTCAGGCCCTGG + Exonic
1180603714 22:17039243-17039265 CAGGGGGACTGCTTGAGCCCGGG - Intergenic
1182336718 22:29588434-29588456 CAGGGGGACTGCTTGAGCCCAGG - Intergenic
1184195347 22:42923947-42923969 CAGGGGAACTGCTTGAGCCCAGG + Intronic
952787134 3:37166628-37166650 CAGGAGTATTGCTCGAGCCCAGG + Intronic
953489668 3:43337975-43337997 CGGAGGGACTGCTTGAGCCCAGG - Intronic
958118163 3:89249551-89249573 CGGGGGAATTGCTCGAGCCCAGG - Intronic
959530739 3:107431552-107431574 CCGCGCTTCCGCCCGAGCCCCGG - Intergenic
959698456 3:109274679-109274701 CAGGGGTACTACTTGAGCCCGGG + Intergenic
961786881 3:129352725-129352747 CAGAGGTCCTGCCCGAGCCCAGG - Intergenic
962593199 3:136912746-136912768 CAGGGGGACTGCTTGAGCCCAGG - Intronic
965877066 3:173336944-173336966 CAAGGGTACTGCTTGAGCCCAGG + Intergenic
969154124 4:5195165-5195187 CCGGAGGACTGCTTGAGCCCAGG - Intronic
971714886 4:30163149-30163171 TGGGGGTACTGCTTGAGCCCAGG + Intergenic
972448153 4:39167087-39167109 CTGGAGGACTGCTCGAGCCCAGG + Intergenic
975954082 4:79815370-79815392 CCACTGTACTGCTCCAGCCTGGG - Intergenic
981915685 4:150030382-150030404 CAGCAGGACTGCTTGAGCCCAGG - Intergenic
984585753 4:181562717-181562739 TCGCGGCACTGCTCTAGCCTGGG - Intergenic
986680892 5:10231973-10231995 CCGGAGGACTGCTTGAGCCCAGG + Intronic
990308621 5:54517865-54517887 CCGCGGTACTGCTCGAGCCCTGG - Exonic
992768741 5:80027666-80027688 CAGGTGGACTGCTCGAGCCCAGG + Intronic
996756827 5:126944488-126944510 CAGGGGAACTGCTTGAGCCCAGG + Intronic
997450227 5:133976585-133976607 CAGCAGGACTGCTTGAGCCCAGG + Intronic
997937546 5:138126718-138126740 CAGCAGTATTGCTTGAGCCCAGG + Intronic
1001457386 5:171874851-171874873 CTGGGGGACTGCTTGAGCCCAGG + Intronic
1002055665 5:176596824-176596846 CCGCGGTGCTGCTCGCGGGCGGG - Exonic
1002698673 5:181107382-181107404 CCCAGCTACTGCTTGAGCCCGGG - Intergenic
1004563660 6:16775373-16775395 CAGGGGGACTGCTTGAGCCCAGG - Intergenic
1005998293 6:30945552-30945574 TGGGGGTACTGCTTGAGCCCAGG + Intronic
1006143986 6:31947347-31947369 GCGGGGTACTGCTCCAACCCGGG + Exonic
1006536472 6:34703070-34703092 CAGCAGGACTGCTCAAGCCCAGG - Intergenic
1006601448 6:35229179-35229201 CAGAGGGACTGCTAGAGCCCAGG + Intronic
1008066646 6:47056750-47056772 CAGAAGTACTGCTTGAGCCCAGG + Intergenic
1008398796 6:51039733-51039755 CAGGGGGACTGCTTGAGCCCAGG - Intergenic
1011041140 6:83031837-83031859 CCAAGGTACAGCTCGGGCCCCGG + Intronic
1016002803 6:139059472-139059494 CAGGGATACTGCTTGAGCCCAGG + Intergenic
1019366123 7:633957-633979 CAGGGGAACTGCTTGAGCCCAGG + Intronic
1019700575 7:2473138-2473160 CAGCAGGACTGCTTGAGCCCAGG - Intergenic
1020096094 7:5370495-5370517 CCCGGGTGCTGCTGGAGCCCAGG - Exonic
1021740962 7:23684856-23684878 CCGGAGGACTGCTTGAGCCCAGG + Intronic
1025980836 7:66404250-66404272 CGGGAGTACTGCTTGAGCCCAGG + Intronic
1026395927 7:69954372-69954394 TGGCGGGACTGCTTGAGCCCAGG - Intronic
1026546848 7:71330627-71330649 CAGAGGAACTGCTTGAGCCCAGG - Intronic
1026609460 7:71844980-71845002 CTGAGGTACTGCTTGAACCCGGG - Intronic
1029727630 7:102417846-102417868 CAGGGGGACTGCTTGAGCCCAGG - Intronic
1032812174 7:135431170-135431192 CAGAAGTACTGCTTGAGCCCAGG + Intronic
1033705511 7:143882347-143882369 CCGCGACCCTGCTCAAGCCCCGG + Intronic
1034025480 7:147698789-147698811 GCAGGGTACTGCTTGAGCCCAGG - Intronic
1034911952 7:155003872-155003894 CCGCGGTGCAGCTCCAGCCCCGG + Intergenic
1036454252 8:8893565-8893587 CCGCGCTCCCGCCCGAGCCCGGG - Exonic
1036942973 8:13069057-13069079 CCGGAGGACTGCTTGAGCCCAGG - Intergenic
1037266432 8:17066772-17066794 CAGGTGGACTGCTCGAGCCCAGG - Intronic
1037861357 8:22407801-22407823 CAGGGGGACTGCTAGAGCCCAGG - Intronic
1039045785 8:33448110-33448132 CAGAGAGACTGCTCGAGCCCAGG + Intronic
1040361453 8:46669006-46669028 CAGGGGAACTGCTTGAGCCCGGG - Intergenic
1041369351 8:57142942-57142964 CCGCGGTACTGCCAGAGCAGGGG + Intergenic
1042236318 8:66616482-66616504 CAGCAGGACTGCTTGAGCCCAGG - Intergenic
1042448331 8:68915798-68915820 CAGGAGTACTGCTTGAGCCCTGG + Intergenic
1042614835 8:70636690-70636712 CAGGGGGACTGCTTGAGCCCAGG + Intronic
1044562636 8:93627931-93627953 CAGGGGCACTGCTTGAGCCCAGG + Intergenic
1045324448 8:101107684-101107706 CGGGAGGACTGCTCGAGCCCAGG + Intergenic
1051308004 9:15736577-15736599 CAGGTGTACTGCTTGAGCCCAGG - Intronic
1051491255 9:17668883-17668905 CAGGGGTACTGCTTGAGCCCAGG - Intronic
1052963797 9:34322761-34322783 GCGGGGTACTGCTTGAGCCTGGG + Intronic
1057768228 9:97942512-97942534 CAGGGGTATTGCTTGAGCCCAGG - Intronic
1061262563 9:129488297-129488319 CCGCGGTCCCCCTCGAGTCCCGG + Intergenic
1061586650 9:131573868-131573890 CCGCGGTACTCCTGGAGTCTGGG - Intergenic
1062660905 9:137632494-137632516 CGGGAGGACTGCTCGAGCCCAGG - Intronic
1062676926 9:137752166-137752188 CCGCCGGCCTGCTCCAGCCCTGG - Intronic
1203632706 Un_KI270750v1:83361-83383 CCGCGGTGCTGCTGGAGACGCGG + Intergenic
1185968666 X:4636653-4636675 CAGCAGGACTGCTTGAGCCCAGG + Intergenic
1186701675 X:12096792-12096814 CAGGAGTATTGCTCGAGCCCAGG + Intergenic
1196413436 X:115444738-115444760 CAGCAGGACTGCTTGAGCCCAGG + Intergenic
1197253798 X:124241672-124241694 AGGCGGTATTGCTTGAGCCCAGG - Intronic
1198137646 X:133770182-133770204 CAGGGGGACTGCTTGAGCCCAGG + Intronic
1201058970 Y:10025862-10025884 CAGCTGTACTGCTTGAGGCCCGG + Intergenic
1202187510 Y:22202168-22202190 CAGCTGGACTGCTTGAGCCCAGG - Intergenic
1202203850 Y:22384228-22384250 CAGCTGGACTGCTTGAGCCCAGG + Intronic