ID: 990308627

View in Genome Browser
Species Human (GRCh38)
Location 5:54517882-54517904
Sequence AGGCCCACCTGAGGGGCCCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 249}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990308627_990308642 15 Left 990308627 5:54517882-54517904 CCGCGGGCCCCTCAGGTGGGCCT 0: 1
1: 0
2: 2
3: 22
4: 249
Right 990308642 5:54517920-54517942 GGAGTCGGGACCGCCAGTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 38
990308627_990308634 -7 Left 990308627 5:54517882-54517904 CCGCGGGCCCCTCAGGTGGGCCT 0: 1
1: 0
2: 2
3: 22
4: 249
Right 990308634 5:54517898-54517920 TGGGCCTCGGCTCGGGACGCCGG 0: 1
1: 0
2: 0
3: 7
4: 119
990308627_990308635 -6 Left 990308627 5:54517882-54517904 CCGCGGGCCCCTCAGGTGGGCCT 0: 1
1: 0
2: 2
3: 22
4: 249
Right 990308635 5:54517899-54517921 GGGCCTCGGCTCGGGACGCCGGG 0: 1
1: 0
2: 1
3: 21
4: 154
990308627_990308640 13 Left 990308627 5:54517882-54517904 CCGCGGGCCCCTCAGGTGGGCCT 0: 1
1: 0
2: 2
3: 22
4: 249
Right 990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG 0: 1
1: 0
2: 0
3: 0
4: 33
990308627_990308641 14 Left 990308627 5:54517882-54517904 CCGCGGGCCCCTCAGGTGGGCCT 0: 1
1: 0
2: 2
3: 22
4: 249
Right 990308641 5:54517919-54517941 GGGAGTCGGGACCGCCAGTCGGG 0: 1
1: 0
2: 0
3: 2
4: 49
990308627_990308643 21 Left 990308627 5:54517882-54517904 CCGCGGGCCCCTCAGGTGGGCCT 0: 1
1: 0
2: 2
3: 22
4: 249
Right 990308643 5:54517926-54517948 GGGACCGCCAGTCGGGGCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 97
990308627_990308638 1 Left 990308627 5:54517882-54517904 CCGCGGGCCCCTCAGGTGGGCCT 0: 1
1: 0
2: 2
3: 22
4: 249
Right 990308638 5:54517906-54517928 GGCTCGGGACGCCGGGAGTCGGG 0: 1
1: 0
2: 0
3: 13
4: 118
990308627_990308637 0 Left 990308627 5:54517882-54517904 CCGCGGGCCCCTCAGGTGGGCCT 0: 1
1: 0
2: 2
3: 22
4: 249
Right 990308637 5:54517905-54517927 CGGCTCGGGACGCCGGGAGTCGG 0: 1
1: 0
2: 2
3: 7
4: 74
990308627_990308647 29 Left 990308627 5:54517882-54517904 CCGCGGGCCCCTCAGGTGGGCCT 0: 1
1: 0
2: 2
3: 22
4: 249
Right 990308647 5:54517934-54517956 CAGTCGGGGCGCCGGGACCATGG 0: 1
1: 0
2: 2
3: 9
4: 150
990308627_990308644 22 Left 990308627 5:54517882-54517904 CCGCGGGCCCCTCAGGTGGGCCT 0: 1
1: 0
2: 2
3: 22
4: 249
Right 990308644 5:54517927-54517949 GGACCGCCAGTCGGGGCGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990308627 Original CRISPR AGGCCCACCTGAGGGGCCCG CGG (reversed) Exonic