ID: 990308627

View in Genome Browser
Species Human (GRCh38)
Location 5:54517882-54517904
Sequence AGGCCCACCTGAGGGGCCCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 249}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990308627_990308644 22 Left 990308627 5:54517882-54517904 CCGCGGGCCCCTCAGGTGGGCCT 0: 1
1: 0
2: 2
3: 22
4: 249
Right 990308644 5:54517927-54517949 GGACCGCCAGTCGGGGCGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 76
990308627_990308640 13 Left 990308627 5:54517882-54517904 CCGCGGGCCCCTCAGGTGGGCCT 0: 1
1: 0
2: 2
3: 22
4: 249
Right 990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG 0: 1
1: 0
2: 0
3: 0
4: 33
990308627_990308637 0 Left 990308627 5:54517882-54517904 CCGCGGGCCCCTCAGGTGGGCCT 0: 1
1: 0
2: 2
3: 22
4: 249
Right 990308637 5:54517905-54517927 CGGCTCGGGACGCCGGGAGTCGG 0: 1
1: 0
2: 2
3: 7
4: 74
990308627_990308638 1 Left 990308627 5:54517882-54517904 CCGCGGGCCCCTCAGGTGGGCCT 0: 1
1: 0
2: 2
3: 22
4: 249
Right 990308638 5:54517906-54517928 GGCTCGGGACGCCGGGAGTCGGG 0: 1
1: 0
2: 0
3: 13
4: 118
990308627_990308647 29 Left 990308627 5:54517882-54517904 CCGCGGGCCCCTCAGGTGGGCCT 0: 1
1: 0
2: 2
3: 22
4: 249
Right 990308647 5:54517934-54517956 CAGTCGGGGCGCCGGGACCATGG 0: 1
1: 0
2: 2
3: 9
4: 150
990308627_990308642 15 Left 990308627 5:54517882-54517904 CCGCGGGCCCCTCAGGTGGGCCT 0: 1
1: 0
2: 2
3: 22
4: 249
Right 990308642 5:54517920-54517942 GGAGTCGGGACCGCCAGTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 38
990308627_990308634 -7 Left 990308627 5:54517882-54517904 CCGCGGGCCCCTCAGGTGGGCCT 0: 1
1: 0
2: 2
3: 22
4: 249
Right 990308634 5:54517898-54517920 TGGGCCTCGGCTCGGGACGCCGG 0: 1
1: 0
2: 0
3: 7
4: 119
990308627_990308643 21 Left 990308627 5:54517882-54517904 CCGCGGGCCCCTCAGGTGGGCCT 0: 1
1: 0
2: 2
3: 22
4: 249
Right 990308643 5:54517926-54517948 GGGACCGCCAGTCGGGGCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 97
990308627_990308635 -6 Left 990308627 5:54517882-54517904 CCGCGGGCCCCTCAGGTGGGCCT 0: 1
1: 0
2: 2
3: 22
4: 249
Right 990308635 5:54517899-54517921 GGGCCTCGGCTCGGGACGCCGGG 0: 1
1: 0
2: 1
3: 21
4: 154
990308627_990308641 14 Left 990308627 5:54517882-54517904 CCGCGGGCCCCTCAGGTGGGCCT 0: 1
1: 0
2: 2
3: 22
4: 249
Right 990308641 5:54517919-54517941 GGGAGTCGGGACCGCCAGTCGGG 0: 1
1: 0
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990308627 Original CRISPR AGGCCCACCTGAGGGGCCCG CGG (reversed) Exonic
900168086 1:1252566-1252588 AGGGCCACCAGAGGGGTCCCTGG + Intergenic
900332699 1:2144159-2144181 AGGCCACACTGAGGGGCCAGCGG - Intronic
900466183 1:2826607-2826629 TGGCCCTCCTGAGGGGCTTGAGG + Intergenic
900969938 1:5986291-5986313 CTGCCCGCCTGAGGGTCCCGTGG + Exonic
901680141 1:10908335-10908357 GAGACCACCTCAGGGGCCCGAGG - Intergenic
902720526 1:18301254-18301276 AGGTCCACTTGTGGGGCCCCTGG + Intronic
903585948 1:24415473-24415495 AGGCCCACCTGCCGGGCAGGTGG + Intronic
904314368 1:29650735-29650757 AGCCCCACGTGAGGGACCCTGGG + Intergenic
904410692 1:30323053-30323075 AGGCCCAGCTGTGGGGCCACCGG + Intergenic
904600052 1:31668165-31668187 AGGCAGTCCTGGGGGGCCCGTGG + Exonic
907471981 1:54679942-54679964 AGGGCCACCTGGCGGGCCCGAGG - Exonic
914428400 1:147599607-147599629 AGAGCCTCCTGAGGGGCCGGCGG - Intronic
917802483 1:178582953-178582975 GGGCTCACCTGAAGGGCCAGTGG - Intergenic
921118165 1:212114008-212114030 AGCCCCACCTGTGAGGCCAGAGG + Intergenic
922533821 1:226365001-226365023 AGCCCCGCCTGAAGCGCCCGTGG - Exonic
922546333 1:226459997-226460019 AGGCCCAGCTGAAGGGTCAGTGG + Intergenic
922618582 1:226977509-226977531 CGGCTCACCTGAGGGGTCCTCGG - Exonic
1062932095 10:1360248-1360270 AGGCCCACCTCTGGGGCTGGGGG - Intronic
1063671516 10:8103367-8103389 ATGCCCGCCTGGGGGGCCCGAGG + Intergenic
1067349771 10:45465364-45465386 AGGCCCACCTGCATGGCCCTTGG + Intronic
1067467714 10:46513425-46513447 AGCCCAACCAGAGGGGGCCGTGG + Intergenic
1067619472 10:47871180-47871202 AGCCCAACCAGAGGGGGCCGTGG - Intergenic
1068261947 10:54594473-54594495 AGGCCCCCTTGAGGTGCCTGGGG - Intronic
1069733842 10:70638402-70638424 AGGATCACCTGAGGGGTTCGAGG - Intergenic
1069789761 10:71012138-71012160 GGGCCCAGCTGAGGGGCTCCAGG - Intergenic
1070780368 10:79134128-79134150 AGGCCCACCTGGGGGGTTCGAGG + Intronic
1071057920 10:81532143-81532165 AGGCCCAGTTGAAGGGTCCGTGG - Intergenic
1073288757 10:102403105-102403127 AGGCCCTCGTGGGTGGCCCGAGG + Exonic
1075711030 10:124530583-124530605 AGGCCCACATGTGTGGCCTGGGG - Intronic
1075974816 10:126685972-126685994 CGGCTCATCTGAGGGGCCCTTGG + Intergenic
1077048108 11:555104-555126 CGGCACACCTGGGGGGCGCGGGG + Exonic
1077063336 11:627065-627087 CGGCTCACCTGGGGGGCGCGGGG + Exonic
1077144115 11:1037152-1037174 AGGACCCCCTGAGGGGCACTGGG + Intergenic
1077259320 11:1607376-1607398 AGGCTCACAGGAGGGGCCCAGGG + Intergenic
1077435751 11:2538382-2538404 AGGCCCCTCTGTGGGGCCCAGGG + Intronic
1083688266 11:64390813-64390835 TGGCCCAACAGAGGGGCCTGTGG + Intergenic
1083904029 11:65658595-65658617 CGGCCCACCTGAGGCCCCCGAGG + Intronic
1084358153 11:68652906-68652928 AGACCCAGCTGCGGGGCCCAGGG - Intergenic
1084371981 11:68750857-68750879 AGGGCCAGGTGAGGGGCCCGGGG + Intronic
1084419065 11:69051212-69051234 GGCCCCACCTGATGGGGCCGGGG + Intronic
1084462086 11:69301881-69301903 AGGCCTGCCTGATGGGCCCCTGG + Intronic
1084800242 11:71538890-71538912 AGGCTCACAGGAGGGGCCCAGGG - Exonic
1087053418 11:93908425-93908447 AGGTCCACCTCTGGGGCCCTGGG - Intergenic
1088167723 11:106957547-106957569 AGGCCCACCTGAGAGCCACACGG - Intronic
1088561549 11:111120693-111120715 AGGGCAACCCGAGGGACCCGAGG + Intergenic
1090562315 11:127945684-127945706 AGGACCACCCTAGGGGCACGTGG + Intergenic
1091108678 11:132944771-132944793 AGGGCCTCCCGAGGGGCCCAAGG - Intronic
1091694492 12:2618595-2618617 GTGGCCACCTGAGGGGCCAGGGG + Intronic
1092926513 12:13277097-13277119 AGGGCCAGCTGAGGGGCTCACGG - Intergenic
1096144012 12:49265292-49265314 AGGTTAACCGGAGGGGCCCGGGG - Intronic
1096529924 12:52236075-52236097 TGGCACACCTGAGGGGCACTGGG + Intronic
1101755559 12:107618292-107618314 AGGCCAAACTGAGGGCCCTGAGG + Exonic
1101897187 12:108765638-108765660 AGCTCCACCTGAGGGGCCTGTGG - Intergenic
1102043337 12:109814757-109814779 AGGCCCCCGCGCGGGGCCCGGGG - Exonic
1102472647 12:113168206-113168228 ATGGTCACCTGAGGGGGCCGTGG + Intronic
1103968142 12:124653063-124653085 AGGAGCACCTGTGGGGCCCCAGG + Intergenic
1104769399 12:131351509-131351531 AGGCCCACCTGGGGAGCACAGGG + Intergenic
1105024072 12:132837114-132837136 AGGAACACCTGAGGGGCTCCAGG + Intronic
1105439391 13:20402858-20402880 TGGCCAACCTGAGGGGGCTGGGG - Intergenic
1106602707 13:31200702-31200724 AGGCCCTGCGGAGGGGCGCGCGG - Intronic
1107467493 13:40664639-40664661 AGGCTGCCCTGAGGGGCCGGGGG - Intronic
1108026442 13:46183277-46183299 GTGACCACCTGAGAGGCCCGTGG - Intronic
1108675576 13:52735147-52735169 AGGGCCACCTGAGGGGAAAGGGG - Intronic
1112793278 13:103027721-103027743 AGGCCCACCTCAGTGGACCCAGG - Intergenic
1113562085 13:111289480-111289502 AGGACCACCTGTGGTGTCCGAGG - Intronic
1113820422 13:113209207-113209229 ACACCCTCCTGAGGGCCCCGGGG - Intronic
1113906968 13:113823815-113823837 AGGCCCGTCTGAGGGGCCACAGG + Intronic
1114083287 14:19219643-19219665 AGGGCCCCCTGAGCTGCCCGGGG + Intergenic
1119378579 14:74214435-74214457 GGGCCCAGCTGAGAGGCCCTGGG + Intergenic
1121322701 14:93001807-93001829 AGGCCCAGCTGAGGGCCACAAGG + Intronic
1122409432 14:101518412-101518434 AGGCCCATCTAACTGGCCCGTGG + Intergenic
1122613584 14:103001760-103001782 CGGCCTTCCTTAGGGGCCCGAGG - Intronic
1122871830 14:104642289-104642311 AGGCCCACCCTGTGGGCCCGGGG - Intergenic
1122888095 14:104719455-104719477 AGGTCCACCTGAGGGGCTGCAGG + Exonic
1123025046 14:105420294-105420316 CGGCCCACCTGTTGGGGCCGAGG + Intronic
1124187301 15:27541879-27541901 AGGCCCAGCTGAGGGCACGGCGG - Exonic
1124595185 15:31086267-31086289 AGCTCCACCTGAGGGGCTAGAGG - Intronic
1124940050 15:34209841-34209863 GGGCCCACCTGCAGGCCCCGCGG - Intronic
1125487454 15:40122142-40122164 AAGCGCAACTGAGGGGCCAGTGG - Intergenic
1129326488 15:74802675-74802697 GGACCCACCTGTGGGGCCTGGGG + Exonic
1129515619 15:76155329-76155351 AGGCCCCTCTGAGGGGCCTGGGG - Intronic
1130301066 15:82680254-82680276 TGCCCCAACCGAGGGGCCCGGGG - Intronic
1130335231 15:82952482-82952504 AGTCCCTCCGGAGGGGCGCGCGG + Intronic
1130550527 15:84887674-84887696 GGGCCCAGTTTAGGGGCCCGGGG - Intronic
1131357520 15:91758530-91758552 AGGCCCACCTTAGAGGGCAGAGG - Intergenic
1131392685 15:92062047-92062069 AGGCCTCCAGGAGGGGCCCGGGG - Intronic
1131438705 15:92442580-92442602 AGGCCTTCCTGAGGGTCCTGGGG - Intronic
1132865525 16:2091167-2091189 AGGCACACCTGTGGGGGGCGCGG + Exonic
1132925277 16:2426043-2426065 AGTCCCACCTGAGTAGCCTGTGG + Intergenic
1132991492 16:2798112-2798134 AGGCCTTCCTGAGGGCCCGGTGG - Intergenic
1132999108 16:2840348-2840370 AGGCTCACCTGATGGGGACGAGG - Intergenic
1135413843 16:22254244-22254266 AGGGCCACCTGCTGGGCCAGAGG - Intronic
1136299054 16:29321081-29321103 AGGCCTACCTGAGGGGCAGTAGG - Intergenic
1138292693 16:55861448-55861470 AGGCCCTGCTGAGGTGCCTGAGG - Exonic
1139475253 16:67199669-67199691 GGCTCCACCTGAGGGGCACGAGG - Exonic
1140477163 16:75244704-75244726 AGGCCCAAGGGAGGGGCCAGGGG + Intronic
1141997726 16:87645863-87645885 ATGCCTACCTGTGGGGCCCGTGG - Intronic
1142245506 16:88968395-88968417 AGCCCCAGCTGAGGGGCCGCAGG + Intronic
1142472775 17:172481-172503 AGGCCCTCTTGAGGACCCCGGGG + Intronic
1143141624 17:4744610-4744632 AGGCTGTCCTGAGGGGCCCCAGG - Exonic
1144583493 17:16473705-16473727 GGTCCCACCTGAGGGTCCAGGGG + Intronic
1144664864 17:17095621-17095643 AGGCACAGCTGAGGGGGCAGGGG - Intronic
1144952916 17:19003768-19003790 GGGCCCCTCTCAGGGGCCCGAGG - Exonic
1146265979 17:31453017-31453039 AGGCCTACCTGACTGGCCCTGGG + Intronic
1146605062 17:34250963-34250985 AGTCCCAGCTGAGGGGCCCAGGG - Intergenic
1148686390 17:49503436-49503458 ATGCCCACCTGGAGGGCTCGAGG + Intronic
1149654339 17:58302400-58302422 AGGCCCACCTGGGGGCCCTGGGG + Exonic
1149774913 17:59349634-59349656 AGGCCAGCCTGTGGGGGCCGGGG - Intronic
1151381912 17:73731705-73731727 AGCCCCATCTGAGAGGGCCGTGG - Intergenic
1151847933 17:76671226-76671248 AAGCCCAGCTGAGGTGCCTGGGG + Intergenic
1151975499 17:77481718-77481740 AGGTCCACCTGGGTGGCCCGAGG + Intronic
1152407901 17:80107962-80107984 AGGTCCGCATGAGGGGCCCTGGG + Intergenic
1152593997 17:81229411-81229433 AGGCTCAGCTGAGGTGCCCCGGG + Exonic
1152614509 17:81331598-81331620 AGGGCCACCTGTGGGGCAGGGGG + Intergenic
1153229829 18:2925032-2925054 AGGCCCACCTGGGGAACCTGTGG - Intronic
1153925671 18:9832880-9832902 AGGCCTCCCTGCGGGGCACGAGG + Intronic
1156473908 18:37394086-37394108 AGACCCGCGGGAGGGGCCCGCGG + Intronic
1160397737 18:78584309-78584331 AGTCCCGGCTGAGGAGCCCGGGG - Intergenic
1162954685 19:14091291-14091313 AGGCGCGCCTGAGGGACGCGGGG - Intergenic
1163020793 19:14479926-14479948 ACCCCCACCTCAGGGGCCTGGGG + Intronic
1163250783 19:16125224-16125246 AGGGTCACCTCAGCGGCCCGGGG + Intronic
1163842413 19:19619243-19619265 TGGCCCACCTGATGGGGCTGAGG - Intergenic
1164669616 19:30065031-30065053 AGCCCAACCTGGGGGGCCCTGGG + Intergenic
1165471443 19:36006928-36006950 AGGTCCACCTGGAGGGCCTGGGG + Exonic
1166319368 19:42006803-42006825 AGGCCCACCTGAAGGGTGGGAGG + Exonic
1167096684 19:47378265-47378287 TGGCCCACCAGACGGGCTCGAGG - Intronic
1168103968 19:54155561-54155583 AGCCCCACCCTGGGGGCCCGGGG + Exonic
1168297293 19:55383707-55383729 AGGCCCAGGTGAGGGGCGGGCGG - Exonic
1168324319 19:55530316-55530338 AGGCCCACCTGCGGGGAGAGGGG + Exonic
926415098 2:12642121-12642143 AGGCCCTCCAGAGGGGCTCGTGG - Intergenic
929405471 2:41636999-41637021 AGGCCCACCTGAGAGCCACATGG + Intergenic
929564562 2:42976447-42976469 AGGGAAACCTGAGGGGCCCAGGG + Intergenic
934697125 2:96407869-96407891 AGCTCCCCCAGAGGGGCCCGGGG + Intergenic
935692821 2:105745441-105745463 GGGCCCGGCTGCGGGGCCCGGGG + Intronic
935737690 2:106119429-106119451 ACTCCCACCTGAGGGGGCTGCGG + Intronic
937108350 2:119340341-119340363 AGGGCCAGCTGAGGGGCCCACGG - Exonic
942689846 2:178573741-178573763 AGGCCCACCTGAAGGACCTTTGG - Exonic
945107802 2:206332440-206332462 AGGCCCAGTTGAGGGGCTGGTGG + Intergenic
945112082 2:206369589-206369611 AGGCCCAGCTGAAGGGTCAGTGG - Intergenic
945484410 2:210378028-210378050 AGGCCGACATCAGGGGCCCTGGG + Intergenic
948624737 2:239261973-239261995 AGGCCAACCTGTAGGGGCCGGGG - Intronic
1171522075 20:25783666-25783688 AGGCCCACCACAGGAGCCCTGGG + Intronic
1171529826 20:25845611-25845633 AGGCCCACCACAGGAGCCCTGGG + Intronic
1171554752 20:26072217-26072239 AGGCCCACCACAGGAGCCCTGGG - Intergenic
1173866790 20:46317595-46317617 AGGACCAGCTGTGGGGCACGGGG - Intergenic
1173868591 20:46328445-46328467 AGGTGCCCCTGAGGGGCCCTGGG + Intergenic
1174175863 20:48644591-48644613 ACGCCCACCTGAGGGCCCAGGGG - Intronic
1175346851 20:58285639-58285661 AGGCAAACCTGAGGGGGGCGAGG + Intergenic
1175525567 20:59631167-59631189 ATGCCCATCTTAGGGGCCCTTGG + Intronic
1176146582 20:63568193-63568215 AGGCCCAGCTCAGGGCACCGAGG - Intronic
1176230376 20:64029664-64029686 AGACACACCTGAGGGTGCCGTGG + Intronic
1176386677 21:6141468-6141490 AGGCCCAGCTGCGGAGCCCCAGG - Intergenic
1176655879 21:9588654-9588676 AGGCCCACCACAGGAGCCCTGGG + Intergenic
1176705854 21:10119684-10119706 AGGACTACCAGAGGGGCCTGCGG + Intergenic
1178488419 21:33033120-33033142 AGCGCCACCTAAGGGGGCCGGGG - Intergenic
1179388211 21:40961900-40961922 AGGCCTTCCTGAGGGGCCTGTGG + Intergenic
1179736796 21:43396784-43396806 AGGCCCAGCTGCGGAGCCCCAGG + Intergenic
1179980157 21:44891481-44891503 AGGCCCATCTCAGGGGCACAAGG - Intronic
1180219553 21:46349545-46349567 AGGCTCAAACGAGGGGCCCGGGG + Intronic
1180294687 22:10873624-10873646 AGGGCCCCCTGAGCTGCCCGGGG - Intergenic
1180497493 22:15903038-15903060 AGGGCCCCCTGAGCTGCCCGGGG - Intergenic
1180748835 22:18110825-18110847 AGGCCCAGCTGAGAGGTGCGCGG + Exonic
1181339470 22:22166374-22166396 AGGCCCACCTGAGGGTCCTCAGG + Intergenic
1181507354 22:23368816-23368838 AGGCCCCACTGAGGTGCCTGAGG - Intergenic
1183315661 22:37135668-37135690 AGGCTCACCAGGGGGGCCCATGG - Intronic
1183357291 22:37366617-37366639 AGCCCCAGCTGAGGGGCCTGAGG + Intergenic
1185106077 22:48870672-48870694 GGGCCCCCCTGTGGGGGCCGGGG + Intergenic
1185119428 22:48957296-48957318 AGGCCAACCTGGGCGTCCCGAGG + Intergenic
1185267979 22:49914526-49914548 AGGACAACCTCAGGGGCCCGTGG + Intronic
950940267 3:16884646-16884668 GCGCCCACCTCAGGGGCCCCAGG - Intronic
952729805 3:36626834-36626856 AGGCCTACAGGAGGGGCCAGAGG + Intergenic
952946045 3:38478390-38478412 AGGCCCACCAGAGGGGATGGTGG - Exonic
955832219 3:63016094-63016116 AGGCCCACCTGAGAGCCACATGG - Intergenic
956873452 3:73440488-73440510 AGCCCAAGCTGAGGGGCCTGAGG + Intronic
960907981 3:122620741-122620763 AGGGACACCCGAGGGGCCCTAGG + Intronic
961013357 3:123449656-123449678 AGGCGCTCCGGGGGGGCCCGCGG + Exonic
961695560 3:128701713-128701735 AGGCCCACCAGAGGGGAACTGGG + Intergenic
961831474 3:129625227-129625249 AGGGCCTCCAGGGGGGCCCGTGG + Intergenic
962319490 3:134378607-134378629 AGACCCACCTGGGGAGCCCTGGG - Intergenic
964979823 3:162665390-162665412 ACGCCCACCAGAGGGACCCTTGG - Intergenic
966635572 3:182129680-182129702 AGGCCCACCTGACGGGACTAGGG - Intergenic
967116893 3:186349667-186349689 AGGCACATCTGAGGGGCCATTGG + Intronic
968172388 3:196521064-196521086 AGGGCCACTTGAGGGGTCCTGGG + Intergenic
968519685 4:1029822-1029844 AGCCCCACCCAATGGGCCCGTGG + Intergenic
968896947 4:3409844-3409866 AGGCCCAGCTGAGGGGCCCTGGG - Intronic
972345715 4:38190816-38190838 TGGCCCAGCTGTGGGGCCTGTGG + Intergenic
980354528 4:131724857-131724879 AGGACTACCAGAGGGGCCTGCGG - Intergenic
980355060 4:131727363-131727385 AGGACTACCAGAGGGGCCTGCGG - Intergenic
980355608 4:131729850-131729872 AGGACTACCAGAGGGGCCTGCGG - Intergenic
980356684 4:131734829-131734851 AGGACTACCAGAGGGGCCTGCGG - Intergenic
980357222 4:131737317-131737339 AGGACTACCAGAGGGGCCTGCGG - Intergenic
980357765 4:131739812-131739834 AGGTCTACCAGAGGGGCCTGCGG - Intergenic
980358301 4:131742298-131742320 AGGACTACCAGAGGGGCCTGCGG - Intergenic
980358835 4:131744792-131744814 AGGTCTACCAGAGGGGCCTGCGG - Intergenic
980359375 4:131747265-131747287 AGGTCTACCAGAGGGGCCTGCGG - Intergenic
980359918 4:131749733-131749755 AGGACTACCAGAGGGGCCTGCGG - Intergenic
980360458 4:131752228-131752250 AGGTCTACCAGAGGGGCCTGCGG - Intergenic
980360999 4:131754700-131754722 AGGTCTACCAGAGGGGCCTGCGG - Intergenic
980361541 4:131757183-131757205 AGGTCTACCAGAGGGGCCTGCGG - Intergenic
980362082 4:131759655-131759677 AGGTCTACCAGAGGGGCCTGCGG - Intergenic
980362624 4:131762138-131762160 AGGTCTACCAGAGGGGCCTGCGG - Intergenic
980363165 4:131764617-131764639 AGGACTACCAGAGGGGCCTGCGG - Intergenic
980378115 4:131976371-131976393 AGGACTACCAGAGGGGCCTGCGG + Intergenic
980794519 4:137663461-137663483 AGGCCCAGCAGAGGGGCCCTGGG - Intergenic
985636451 5:1038104-1038126 TGGCCGTCCTGAGGGGCCTGGGG - Exonic
985698877 5:1358675-1358697 AGCCCCACCTGAGGGGGAAGAGG + Intergenic
985863009 5:2488911-2488933 AGGCCCAGCTGAGTGGCTGGAGG + Intergenic
986184464 5:5422868-5422890 ACGCACGCCTCAGGGGCCCGCGG - Exonic
990015960 5:51063467-51063489 CGGCCCACCTGAGGGCCACAAGG + Intergenic
990308627 5:54517882-54517904 AGGCCCACCTGAGGGGCCCGCGG - Exonic
998522538 5:142813902-142813924 AGGCCCACCTGAGGAACTCAAGG - Intronic
1002204668 5:177554308-177554330 AGGCCCTCCGGAGGCGCCGGCGG - Exonic
1002279784 5:178123515-178123537 GGACCCACCTGTGGGGCCTGAGG - Exonic
1003012034 6:2435382-2435404 GGGCCCACCTCACGGTCCCGGGG + Intergenic
1007721034 6:43885607-43885629 AGGCCCACCAGATGGGGCTGGGG - Intergenic
1008834493 6:55808727-55808749 TGGCCCACCTGAGGGCCTCATGG - Intronic
1008906136 6:56679661-56679683 CCTCCCACCTCAGGGGCCCGAGG - Intronic
1013070928 6:106728532-106728554 AGGCCTAACTGTGGGGCCCCGGG + Intergenic
1013246420 6:108291350-108291372 AGGAACACTTGAGGGGCCTGGGG + Intergenic
1018458193 6:163971572-163971594 AGACCCACTTGGGGGCCCCGTGG + Intergenic
1019492956 7:1323667-1323689 AGGCCCAGCCGAGAGGCCAGCGG - Intergenic
1019686429 7:2384496-2384518 AGCCCACCCTGAGGGGCACGGGG + Intergenic
1020474842 7:8582703-8582725 TGGCCCACCTGTGGGGCCCATGG - Intronic
1021600150 7:22356745-22356767 ACGCCCCCCTCAGCGGCCCGGGG + Intronic
1022310633 7:29193877-29193899 AGGCCAACCTCAGAGGCCCACGG + Intronic
1022701353 7:32763050-32763072 AGGCCCGCCCGTGGTGCCCGCGG + Intergenic
1022978301 7:35578424-35578446 AGGCTTACCTGAGTGGCCAGCGG + Intergenic
1023580791 7:41680751-41680773 GGGCCCACATGAGATGCCCGAGG - Intergenic
1025060119 7:55798405-55798427 GGGCTCCCCTGAGGGGCCCAGGG - Intronic
1025302154 7:57826569-57826591 AGGCCCACCACAGGAGCCCTGGG - Intergenic
1026473950 7:70718121-70718143 AGGCCCACCTGATGGGGTGGGGG - Intronic
1027226588 7:76247583-76247605 AGCCTCACCTGAGGGGCGAGGGG + Intronic
1030733221 7:113014297-113014319 AGGCCCACCCCATGGGCCCAGGG - Intergenic
1032015982 7:128380726-128380748 AGGAGCAGCTGAGGGGCCTGTGG + Intergenic
1032095073 7:128933937-128933959 AGGCCCAGCTGTGGCGCCCTGGG + Intergenic
1032262379 7:130347657-130347679 AGGCCCAGCTGAGGGCCAGGCGG - Intronic
1032678329 7:134154472-134154494 AGGCCCACATGAGGTGACTGTGG + Intronic
1032919840 7:136533688-136533710 TGGCCCACCTGAGAGCCACGTGG + Intergenic
1033604276 7:142914439-142914461 AGGCCAACCTGAGTGGCCCCTGG + Intronic
1033660177 7:143397398-143397420 AGGACCACCTCAGGGGTCCGAGG + Intronic
1034283787 7:149871281-149871303 AGCTCCACCTCAGGGGACCGGGG + Intergenic
1034968323 7:155404736-155404758 GGGCCCCGCTGGGGGGCCCGTGG - Intergenic
1035174451 7:157040299-157040321 AAGCCCACAGCAGGGGCCCGAGG + Intergenic
1035426700 7:158782924-158782946 AGGTCCACATGAGGGCACCGTGG + Intronic
1037390544 8:18387363-18387385 AGGCCAACGTGAAGGGGCCGCGG - Intergenic
1042198919 8:66259987-66260009 AGGCCCACCTGAAGTGGCAGTGG - Intergenic
1043865013 8:85364878-85364900 AGTGCCAGCTGAGGGGCACGTGG + Intronic
1049354472 8:142180820-142180842 ATGCCCACCTGGGGGCCCCCGGG + Intergenic
1049573150 8:143378858-143378880 AGGCCCAGCTGCGGGAACCGTGG + Intronic
1051036096 9:12747128-12747150 AGGCCCACCTGAGAGCCACACGG - Intergenic
1053643136 9:40106803-40106825 AGGACTACCAGAGGGGCCTGCGG + Intergenic
1053763013 9:41358686-41358708 AGGACTACCAGAGGGGCCTGCGG - Intergenic
1054323987 9:63704031-63704053 AGGACTACCAGAGGGGCCTGCGG + Intergenic
1054541619 9:66269800-66269822 AGGACTACCAGAGGGGCCTGCGG - Intergenic
1056544328 9:87601307-87601329 AGGCCCACCTGGGGGCCTCTGGG - Intronic
1057895688 9:98906918-98906940 AGGCCCAGCTGCCGGGCCCATGG + Intergenic
1057935979 9:99239362-99239384 GAGCCCACCTGAGGAGCCAGAGG - Intergenic
1058342636 9:103917686-103917708 AGGCCCACATCAGAGGCCCTAGG - Intergenic
1058973647 9:110106181-110106203 AGGCTAACCTGATGGGCCCAAGG - Intronic
1059279538 9:113120579-113120601 AGAACCACCTGGGGGGCTCGTGG + Intergenic
1059346784 9:113634441-113634463 GGGCCCACCTGTGGAGCCCTCGG - Intergenic
1059407773 9:114112562-114112584 AGCCCTGCCTGAGGGGCCCTTGG + Intergenic
1060201235 9:121652630-121652652 AGGCCCACCGAGGGTGCCCGTGG + Intronic
1060599686 9:124869543-124869565 AGGCTGACCTGAGGGGGCCAAGG - Intronic
1061666118 9:132161894-132161916 TGGCCCCCCTGGGCGGCCCGGGG - Intronic
1062375325 9:136259412-136259434 AGGCCCAGCAGAGGGGCCCGAGG + Intergenic
1062428555 9:136517031-136517053 AGGCCCCCCTCAGGAGGCCGGGG + Intronic
1062438236 9:136556623-136556645 AGGCCCACGTGAGAGGACCCTGG - Intergenic
1202790888 9_KI270719v1_random:89773-89795 AGGACTACCAGAGGGGCCTGCGG + Intergenic
1203633596 Un_KI270750v1:92115-92137 AGGCCCACCACAGGAGCCCTGGG + Intergenic
1192130599 X:68546044-68546066 AGGCCCACAAGAGGGGTCCCTGG + Intergenic
1192788084 X:74354209-74354231 AGGCCCACCCCAGTGGCCCCAGG + Intergenic
1194307421 X:92265372-92265394 AAGCCGAGCTCAGGGGCCCGTGG + Intronic
1197760231 X:130022810-130022832 AAGCCCACCTGTGAGGCTCGGGG - Intronic