ID: 990308629

View in Genome Browser
Species Human (GRCh38)
Location 5:54517889-54517911
Sequence CGAGCCGAGGCCCACCTGAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 82}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990308629_990308640 6 Left 990308629 5:54517889-54517911 CCCCTCAGGTGGGCCTCGGCTCG 0: 1
1: 0
2: 1
3: 3
4: 82
Right 990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG 0: 1
1: 0
2: 0
3: 0
4: 33
990308629_990308647 22 Left 990308629 5:54517889-54517911 CCCCTCAGGTGGGCCTCGGCTCG 0: 1
1: 0
2: 1
3: 3
4: 82
Right 990308647 5:54517934-54517956 CAGTCGGGGCGCCGGGACCATGG 0: 1
1: 0
2: 2
3: 9
4: 150
990308629_990308641 7 Left 990308629 5:54517889-54517911 CCCCTCAGGTGGGCCTCGGCTCG 0: 1
1: 0
2: 1
3: 3
4: 82
Right 990308641 5:54517919-54517941 GGGAGTCGGGACCGCCAGTCGGG 0: 1
1: 0
2: 0
3: 2
4: 49
990308629_990308638 -6 Left 990308629 5:54517889-54517911 CCCCTCAGGTGGGCCTCGGCTCG 0: 1
1: 0
2: 1
3: 3
4: 82
Right 990308638 5:54517906-54517928 GGCTCGGGACGCCGGGAGTCGGG 0: 1
1: 0
2: 0
3: 13
4: 118
990308629_990308637 -7 Left 990308629 5:54517889-54517911 CCCCTCAGGTGGGCCTCGGCTCG 0: 1
1: 0
2: 1
3: 3
4: 82
Right 990308637 5:54517905-54517927 CGGCTCGGGACGCCGGGAGTCGG 0: 1
1: 0
2: 2
3: 7
4: 74
990308629_990308644 15 Left 990308629 5:54517889-54517911 CCCCTCAGGTGGGCCTCGGCTCG 0: 1
1: 0
2: 1
3: 3
4: 82
Right 990308644 5:54517927-54517949 GGACCGCCAGTCGGGGCGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 76
990308629_990308643 14 Left 990308629 5:54517889-54517911 CCCCTCAGGTGGGCCTCGGCTCG 0: 1
1: 0
2: 1
3: 3
4: 82
Right 990308643 5:54517926-54517948 GGGACCGCCAGTCGGGGCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 97
990308629_990308642 8 Left 990308629 5:54517889-54517911 CCCCTCAGGTGGGCCTCGGCTCG 0: 1
1: 0
2: 1
3: 3
4: 82
Right 990308642 5:54517920-54517942 GGAGTCGGGACCGCCAGTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990308629 Original CRISPR CGAGCCGAGGCCCACCTGAG GGG (reversed) Exonic
900574008 1:3374103-3374125 CCAGCCCTGGCCCTCCTGAGAGG - Intronic
908120889 1:60984943-60984965 AGAGCCCAGGGCCACTTGAGTGG - Intronic
1067161009 10:43825385-43825407 CAAGCAGGCGCCCACCTGAGGGG - Intergenic
1069795886 10:71051481-71051503 CGTGCCCAGGCCCTCCTGAGTGG + Intergenic
1070827928 10:79401915-79401937 GGAGCCCAGGGCCACCTCAGCGG - Intronic
1072660665 10:97361615-97361637 CTGGCCGAAGCCCAGCTGAGTGG + Intronic
1072936807 10:99720972-99720994 TGAGCTGAGTCCTACCTGAGAGG + Exonic
1075004084 10:118818128-118818150 CCACCCCAGCCCCACCTGAGCGG - Intergenic
1075263163 10:120980089-120980111 CCAGAGGAGGCCCGCCTGAGGGG + Intergenic
1075573057 10:123559179-123559201 AGAGCCGAGGCACAGGTGAGCGG + Intergenic
1076307545 10:129475687-129475709 CCAGCCCAGGCCAGCCTGAGAGG + Intronic
1076476624 10:130758189-130758211 TGAGGTGAGTCCCACCTGAGCGG - Intergenic
1077244466 11:1529507-1529529 CAGGCCGACGCTCACCTGAGCGG + Intergenic
1078447798 11:11417616-11417638 TGAGCCCAAGCCCTCCTGAGAGG - Intronic
1079035099 11:17014110-17014132 CGGCCCGGCGCCCACCTGAGCGG + Exonic
1083665032 11:64269570-64269592 CGTGCCGCGGCCCCCCAGAGAGG - Intergenic
1083922413 11:65787791-65787813 GGAGCCGAGGGTCGCCTGAGCGG - Intronic
1084954445 11:72683999-72684021 AGCCCTGAGGCCCACCTGAGTGG - Intergenic
1088758513 11:112907307-112907329 CGAGCCCAGGCCCAGGCGAGGGG + Intergenic
1091728826 12:2864870-2864892 AGAGAGGAGGCCAACCTGAGGGG + Intronic
1094320263 12:29174925-29174947 TGAGCCGAGGGTCACCAGAGAGG - Intronic
1094541897 12:31369725-31369747 AGAGCCAAGCCCCACCTGGGAGG - Intergenic
1104728696 12:131093482-131093504 GGAGCCAGGGCCCATCTGAGAGG - Intronic
1104949588 12:132433333-132433355 CGAGCAGACGCGCACCTGTGCGG - Intergenic
1114863211 14:26553481-26553503 CAAGCAGAGGTCCAACTGAGAGG - Intronic
1119601393 14:75979396-75979418 TCAGCCCAGGCCCACCTGGGAGG - Intronic
1119756674 14:77124796-77124818 CGAGCCCAGCCCCTCCTGGGAGG - Intronic
1122093141 14:99353081-99353103 GAAGCCGCGCCCCACCTGAGTGG - Intergenic
1126087629 15:45024178-45024200 CCATCCCAGGCCCATCTGAGAGG - Intronic
1128252802 15:66174670-66174692 CCAGCCCAGCCCCACCTGTGGGG + Intronic
1129735569 15:77959656-77959678 CGTGCCGCTGCCCAGCTGAGCGG - Intergenic
1136428357 16:30183757-30183779 CGGGGCGAGGGCCACCTGTGGGG + Intronic
1136512599 16:30748483-30748505 CTAGCGCAGGCTCACCTGAGGGG - Exonic
1141531299 16:84648642-84648664 CGCGCGGAGGCCCACCTGGCAGG - Exonic
1142352515 16:89586635-89586657 CAAGCAGAGGCCCCCCAGAGTGG - Intronic
1143561987 17:7701857-7701879 TGAGCCGGGGGCCACCTGTGGGG + Intronic
1144730160 17:17521396-17521418 CTAGACAAGGCCCACCTGCGTGG - Intronic
1144851892 17:18248019-18248041 CAAGCCCAGGCCCACCTGGCAGG + Exonic
1146520576 17:33522397-33522419 TGGGCTGAGGCCCACCTGTGGGG + Intronic
1146912580 17:36658098-36658120 CGCTCCGAGGCCCGCCTGGGAGG + Intergenic
1150143511 17:62749840-62749862 CACGCCGAGGCCGCCCTGAGCGG - Intronic
1152013491 17:77735075-77735097 ACAGACCAGGCCCACCTGAGGGG + Intergenic
1154241640 18:12658213-12658235 CGAGGCGAGGCCCTCCTGCCTGG - Exonic
1163639020 19:18451127-18451149 CCAGCTGAGGCCACCCTGAGCGG - Intronic
1164722583 19:30443608-30443630 GAAGCTGAGCCCCACCTGAGTGG + Exonic
1166212911 19:41318733-41318755 GGAAGCCAGGCCCACCTGAGGGG + Intronic
925291024 2:2748825-2748847 AGAGGTGAGGCCCACCTGGGAGG + Intergenic
944534454 2:200695493-200695515 CCAGTCCAGGCCCACCAGAGAGG + Intergenic
947398896 2:229713812-229713834 CGAGCCAAGAACCACTTGAGCGG - Intronic
947543056 2:230991598-230991620 CTAGCGGAGTTCCACCTGAGAGG - Intergenic
1169215892 20:3794747-3794769 AGACCCCAGCCCCACCTGAGAGG - Intronic
1169721478 20:8682211-8682233 CGTGCCCAGGCCCAGCTCAGCGG + Intronic
1173185510 20:40837047-40837069 GGAGCTGGGGCACACCTGAGGGG - Intergenic
1175943972 20:62550304-62550326 CCAGCCGCGGCCCAGCTGACAGG + Intergenic
1179511734 21:41878536-41878558 CGAGGCGGGCCTCACCTGAGCGG + Intronic
1181019540 22:20092129-20092151 GGAGCCGCGCCCCATCTGAGTGG + Intronic
1181772838 22:25139230-25139252 GGAGCCGAGGCCCCCCTGATGGG + Intronic
1182511319 22:30822409-30822431 GGAGCCGAGCCCAGCCTGAGCGG - Intronic
1183742154 22:39674705-39674727 AGAGCAGAGGCCACCCTGAGGGG - Intronic
1185335778 22:50270348-50270370 CGAGCCGAGCCCGAGCCGAGCGG + Exonic
950680703 3:14583311-14583333 CAAACCTAGGCCCACCTCAGTGG + Intergenic
950765901 3:15272869-15272891 GTAGCTGAGGCACACCTGAGTGG - Intronic
953880641 3:46689642-46689664 CCTGCCTAGGCCCAGCTGAGGGG + Intronic
960995361 3:123336722-123336744 AGAGGCCTGGCCCACCTGAGTGG - Intronic
961750512 3:129091390-129091412 CAAGCCCAGTCCCACCTGGGAGG + Intronic
968896949 4:3409851-3409873 CTAGGCGAGGCCCAGCTGAGGGG - Intronic
969427702 4:7135381-7135403 CTTGCCGAGGCGCCCCTGAGAGG + Intergenic
990308629 5:54517889-54517911 CGAGCCGAGGCCCACCTGAGGGG - Exonic
1001617667 5:173056326-173056348 CTCGCCGCGGCCCACGTGAGGGG + Intergenic
1001928745 5:175658171-175658193 CGAGCCGAGGCCCCGCGGGGAGG - Intronic
1006939624 6:37743239-37743261 AGAGCCATGGTCCACCTGAGAGG + Intergenic
1015764975 6:136706647-136706669 CCAGGCGAGGCCCGGCTGAGTGG + Intronic
1017845799 6:158257256-158257278 AGAGCTGAGGCTGACCTGAGTGG - Intronic
1018921544 6:168179338-168179360 TGAGGCGAGGACCACCTGCGGGG + Intergenic
1018921556 6:168179387-168179409 TGAGGCGAGGACCACCTGTGGGG + Intergenic
1023655492 7:42415406-42415428 CAAGCTGAGGCTCTCCTGAGTGG + Intergenic
1024293858 7:47827398-47827420 CCATCCAAGGCCCAGCTGAGGGG - Exonic
1029376114 7:100177735-100177757 CGTGCCCAAGCCCACGTGAGAGG + Exonic
1035437717 7:158871555-158871577 CAAGCGGGGACCCACCTGAGCGG - Exonic
1035624633 8:1061669-1061691 GGAGCCGGGGCCCAGGTGAGTGG + Intergenic
1040027671 8:42796657-42796679 CGAGCCGACGCCCACCTGTGGGG - Intergenic
1044322479 8:90819801-90819823 AGAGCCCTGTCCCACCTGAGAGG - Intronic
1047496979 8:125415497-125415519 CAAGCTGAGGCCTGCCTGAGTGG + Intergenic
1049207051 8:141368474-141368496 AGTGCCGAGGCCCTGCTGAGTGG + Intergenic
1050382313 9:5042713-5042735 CTTGCCCAGGCCCACCTGGGAGG + Intronic
1057230856 9:93320594-93320616 CTGGCCGAGGGCCACCAGAGAGG - Intronic
1062294489 9:135816941-135816963 GGTCCCGGGGCCCACCTGAGAGG + Intronic