ID: 990308630

View in Genome Browser
Species Human (GRCh38)
Location 5:54517890-54517912
Sequence CCGAGCCGAGGCCCACCTGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 112}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990308630_990308647 21 Left 990308630 5:54517890-54517912 CCCTCAGGTGGGCCTCGGCTCGG 0: 1
1: 0
2: 1
3: 12
4: 112
Right 990308647 5:54517934-54517956 CAGTCGGGGCGCCGGGACCATGG 0: 1
1: 0
2: 2
3: 9
4: 150
990308630_990308642 7 Left 990308630 5:54517890-54517912 CCCTCAGGTGGGCCTCGGCTCGG 0: 1
1: 0
2: 1
3: 12
4: 112
Right 990308642 5:54517920-54517942 GGAGTCGGGACCGCCAGTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 38
990308630_990308637 -8 Left 990308630 5:54517890-54517912 CCCTCAGGTGGGCCTCGGCTCGG 0: 1
1: 0
2: 1
3: 12
4: 112
Right 990308637 5:54517905-54517927 CGGCTCGGGACGCCGGGAGTCGG 0: 1
1: 0
2: 2
3: 7
4: 74
990308630_990308643 13 Left 990308630 5:54517890-54517912 CCCTCAGGTGGGCCTCGGCTCGG 0: 1
1: 0
2: 1
3: 12
4: 112
Right 990308643 5:54517926-54517948 GGGACCGCCAGTCGGGGCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 97
990308630_990308644 14 Left 990308630 5:54517890-54517912 CCCTCAGGTGGGCCTCGGCTCGG 0: 1
1: 0
2: 1
3: 12
4: 112
Right 990308644 5:54517927-54517949 GGACCGCCAGTCGGGGCGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 76
990308630_990308641 6 Left 990308630 5:54517890-54517912 CCCTCAGGTGGGCCTCGGCTCGG 0: 1
1: 0
2: 1
3: 12
4: 112
Right 990308641 5:54517919-54517941 GGGAGTCGGGACCGCCAGTCGGG 0: 1
1: 0
2: 0
3: 2
4: 49
990308630_990308640 5 Left 990308630 5:54517890-54517912 CCCTCAGGTGGGCCTCGGCTCGG 0: 1
1: 0
2: 1
3: 12
4: 112
Right 990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG 0: 1
1: 0
2: 0
3: 0
4: 33
990308630_990308638 -7 Left 990308630 5:54517890-54517912 CCCTCAGGTGGGCCTCGGCTCGG 0: 1
1: 0
2: 1
3: 12
4: 112
Right 990308638 5:54517906-54517928 GGCTCGGGACGCCGGGAGTCGGG 0: 1
1: 0
2: 0
3: 13
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990308630 Original CRISPR CCGAGCCGAGGCCCACCTGA GGG (reversed) Exonic
900208521 1:1441727-1441749 CTGAGCCCAGGCCCAGCTCACGG + Exonic
901404551 1:9037774-9037796 ACGGGCCGAGGCCCTCCTGCGGG + Exonic
901753839 1:11428942-11428964 CCGTGGGGAGGCCCAGCTGATGG - Intergenic
904972372 1:34429065-34429087 TGGAGCCGGGGCCCCCCTGATGG - Intergenic
905776244 1:40669027-40669049 CCGAGCCGAAGTCCTCCTGGAGG + Intergenic
908104141 1:60824153-60824175 GGGAGCCGAGGCCCACATAAGGG - Intergenic
908398354 1:63746797-63746819 CAGAGACTAGGCCCACCTGCAGG + Intergenic
914876242 1:151514279-151514301 CCCAGCCTAGGCCCAGCAGAGGG - Intronic
920186679 1:204163681-204163703 CAGAGCTGAGGCCCACGGGAAGG - Intronic
1064311235 10:14213558-14213580 CCTAGCCCAGGGCAACCTGAGGG - Intronic
1066656069 10:37700986-37701008 CTGTCCCGAGGCCCACGTGAAGG + Intergenic
1067161010 10:43825386-43825408 CCAAGCAGGCGCCCACCTGAGGG - Intergenic
1067214971 10:44293821-44293843 CCAAGCAGGTGCCCACCTGAGGG + Intronic
1067249109 10:44572358-44572380 CCGGGCAAAGGCCCACCTGAAGG - Intergenic
1075263161 10:120980088-120980110 CCCAGAGGAGGCCCGCCTGAGGG + Intergenic
1076109063 10:127847455-127847477 CCCAGCCGAGCCACACCCGATGG + Intergenic
1077081425 11:726200-726222 CCGGGCCCAGGGCCACCTGGGGG + Intronic
1077175476 11:1187958-1187980 CCGAGCCGAGAGCCACCCGGAGG + Intronic
1077175864 11:1190151-1190173 CCGAGCCGAGAGCCACCCGGAGG + Intronic
1077176228 11:1192173-1192195 CCGAGCCGAGAGCCACCCGGAGG + Intronic
1080567590 11:33526009-33526031 CCTACCCCAGCCCCACCTGATGG + Intergenic
1080592698 11:33737114-33737136 CTGAGGCGAGGCCACCCTGAAGG - Intergenic
1080730108 11:34941861-34941883 CAGAGCAGAGGCCCACCCGGGGG - Intronic
1081869607 11:46377331-46377353 CCTGGCCAAAGCCCACCTGACGG + Intronic
1082916866 11:58446677-58446699 CCTAGCCCTGCCCCACCTGATGG + Intergenic
1086839577 11:91667897-91667919 CCCAGCACAGGCCCACCTCATGG + Intergenic
1088758512 11:112907306-112907328 CCGAGCCCAGGCCCAGGCGAGGG + Intergenic
1089401360 11:118166445-118166467 CCAGGCCAAGGCCCTCCTGAGGG + Exonic
1091398511 12:169099-169121 CGGAGCCGAGGCTCACCTGTCGG - Exonic
1092536238 12:9389992-9390014 CCGAGCAAAGGCCCAACTGAAGG + Intergenic
1101671035 12:106873153-106873175 CCCAGCAGATGCCCAACTGAAGG + Intronic
1102203586 12:111075036-111075058 CCTGGCCGAGTCACACCTGAGGG + Intronic
1113730523 13:112638137-112638159 CTGAGCTGATGGCCACCTGAGGG + Intergenic
1113913775 13:113857971-113857993 CCGGGCCGGGGTCCACCTGCAGG + Intronic
1122357326 14:101131557-101131579 CTGATCCGAGGCCAACCTGGAGG - Intergenic
1122627733 14:103092733-103092755 CCCAGCCCAGTCCCACCTGCTGG - Intergenic
1124018965 15:25902762-25902784 CCGAGCAGGGGTCAACCTGAGGG + Intergenic
1128252800 15:66174669-66174691 CCCAGCCCAGCCCCACCTGTGGG + Intronic
1128479250 15:68023139-68023161 CCGCGCCCGGCCCCACCTGATGG + Intergenic
1129919901 15:79311214-79311236 CCGAGCCGCGGCCCTCGAGACGG + Exonic
1132426857 15:101724669-101724691 CTGAGGCCAGGCCCACCTTAGGG + Intergenic
1132573597 16:654942-654964 CCCAGCCGAGCCCCACCCGGAGG - Intronic
1132894758 16:2223534-2223556 CCGCGCCGAGGCCAGCGTGAGGG - Intergenic
1136428356 16:30183756-30183778 CCGGGGCGAGGGCCACCTGTGGG + Intronic
1141184052 16:81774505-81774527 ACGAGCCGAGTCCCAGCTGCTGG - Intronic
1142122987 16:88396457-88396479 CCGGGCGGAGACCCTCCTGAAGG + Intergenic
1142123032 16:88396592-88396614 CCGGGCGGAGACCCATCTGAAGG + Intergenic
1142123051 16:88396646-88396668 CCGGGCGGAGACCCTCCTGAAGG + Intergenic
1142681918 17:1554993-1555015 CCAAGCCCTGACCCACCTGACGG - Intronic
1142738601 17:1917454-1917476 CCGAGCCGCAGCCACCCTGACGG - Intergenic
1143105013 17:4525187-4525209 CCGAGCCGGGCCTCACCTGCTGG - Exonic
1143586762 17:7854332-7854354 CCGACCCCAGCCCCACCTGAGGG + Exonic
1145013626 17:19383314-19383336 CCAAGCCGAGCCTCACCTGCTGG - Exonic
1146258368 17:31404938-31404960 CTGTGCAGAGGCCCACCTGCAGG + Intronic
1146399095 17:32489433-32489455 CCAAGCCGGTGCCCACCTAAGGG + Exonic
1152013490 17:77735074-77735096 CACAGACCAGGCCCACCTGAGGG + Intergenic
1152577864 17:81150770-81150792 CCCTGCCGAGGCCCACCTGCTGG - Intronic
1152643852 17:81459989-81460011 CCCAGCCGAGTCCCGCCTGGAGG - Intronic
1154954654 18:21242341-21242363 CCGAGCCGAGGGCCACCCCCTGG + Intronic
1156046833 18:32886603-32886625 CCGCGCCCAGCCCCACATGAAGG + Intergenic
1157544907 18:48540294-48540316 CCGAGCCGGAGCCCACCCCACGG - Intronic
1157662841 18:49460570-49460592 CCGAGCCGGGGCCGAGCTGCAGG - Exonic
1161760608 19:6168305-6168327 CTGAGCAGAGACCCACCCGAAGG - Intronic
1162770849 19:12948596-12948618 CCCAGACAAGGCCCAGCTGATGG - Intronic
1165738842 19:38193842-38193864 CCGAGCAGGGGCTCACCTGGAGG + Intronic
1168370668 19:55831232-55831254 CGGAGCCTAGGCACAACTGACGG + Intronic
931557899 2:63525226-63525248 CAGACCCAAGGCCTACCTGAGGG + Intronic
932359499 2:71092619-71092641 CCGAGCCGTGCCCCACGGGAAGG + Intergenic
936068466 2:109349661-109349683 CAGAGCCGAGGCCCTCCTCCAGG + Intronic
937078027 2:119121243-119121265 CTGAGGCGAGGCCCACCTTCAGG + Intergenic
947652544 2:231799075-231799097 CCTAGCCCAGGCCCACTTGTTGG - Intronic
1171436694 20:25130225-25130247 CTGAGGGGAGTCCCACCTGAAGG - Intergenic
1174170869 20:48617576-48617598 CTGAGCCGAGGCCCATCTGGCGG + Intergenic
1175263801 20:57690728-57690750 CCCAGCCGACCCCCACCTGCCGG + Intronic
1179908970 21:44438109-44438131 CGGAGCCCAGGCCCAGCTGCTGG + Intronic
1180908548 22:19432237-19432259 CGGAGCCGAGGCCCGCGCGAGGG + Exonic
1181391723 22:22588056-22588078 CTGAGCCCAGGCCCAGGTGAGGG + Intergenic
1181407884 22:22697792-22697814 CTGAGCCCAGGCCCACGTGAGGG + Intergenic
1181412542 22:22734460-22734482 CTGAGCCCAGGCCCAGGTGAGGG + Intergenic
1181415878 22:22758581-22758603 CTGAGCCCAGGCCCAGGTGAGGG + Intronic
1181772837 22:25139229-25139251 GGGAGCCGAGGCCCCCCTGATGG + Intronic
1182872809 22:33663585-33663607 CAGGACAGAGGCCCACCTGAGGG + Intronic
1185372767 22:50468628-50468650 CAGACCCCAGGGCCACCTGAGGG + Intronic
1185398699 22:50605142-50605164 CAGTGCCCAGGGCCACCTGAGGG + Intronic
953413008 3:42700879-42700901 CCAAGCCTAGCCCCACCTCATGG + Intronic
953835953 3:46344323-46344345 CCAGGCAAAGGCCCACCTGAAGG - Intergenic
953880639 3:46689641-46689663 CCCTGCCTAGGCCCAGCTGAGGG + Intronic
958490477 3:94766261-94766283 CCTAGCCCTGCCCCACCTGATGG - Intergenic
966878251 3:184335789-184335811 CAGAGCCGACTGCCACCTGAAGG - Intronic
968896950 4:3409852-3409874 CCTAGGCGAGGCCCAGCTGAGGG - Intronic
977756355 4:100676486-100676508 CCAAGCAAAGGCCCAACTGAAGG + Intronic
978061417 4:104344820-104344842 CCGTGCCGAGGGACACCTGCAGG - Intergenic
981044471 4:140252869-140252891 CCGAGCGCAGGCCCGCCCGACGG - Intergenic
981400969 4:144313515-144313537 CCTAGCCCTGCCCCACCTGATGG - Intergenic
981701656 4:147614087-147614109 CCCAGCCGAGGCCCTCATCATGG - Intergenic
985650353 5:1104658-1104680 CAGAGCCGAGGCCCACCGGGGGG + Intronic
985665341 5:1179235-1179257 CCCAGCTGAGCCTCACCTGAGGG - Intergenic
990308630 5:54517890-54517912 CCGAGCCGAGGCCCACCTGAGGG - Exonic
996398522 5:123036142-123036164 CCGAGCCCAGGCCACGCTGAAGG + Intronic
999261934 5:150243825-150243847 CCCAGCCGAGGTCCAGCTGCAGG + Intronic
1001617666 5:173056325-173056347 CCTCGCCGCGGCCCACGTGAGGG + Intergenic
1002541262 5:179907838-179907860 CCGGGCCGAGGCCCGCGAGACGG + Exonic
1005966497 6:30730502-30730524 CCGAGCCGAGGCTGAGCAGATGG - Exonic
1007782544 6:44262864-44262886 CCCAGCCAAGGCCCTCCTGAAGG - Intronic
1017215410 6:151901055-151901077 CCTAGCCTTGCCCCACCTGATGG - Intronic
1018921543 6:168179337-168179359 CTGAGGCGAGGACCACCTGCGGG + Intergenic
1018921555 6:168179386-168179408 CTGAGGCGAGGACCACCTGTGGG + Intergenic
1019340185 7:505235-505257 CCAAGCCGAAGCCCAAGTGATGG + Intronic
1032262381 7:130347665-130347687 TGGAGCAGAGGCCCAGCTGAGGG - Intronic
1033049103 7:137988128-137988150 CCGACCTCAGGCCCAGCTGAAGG + Intronic
1035067393 7:156117019-156117041 CAGAGCCGAGGGCCTCCAGAAGG + Intergenic
1035259355 7:157651928-157651950 CTGAGTCGAGGCTCACCTGCGGG - Intronic
1037865862 8:22441503-22441525 CCGAGCCGCCGCCCAGCCGAAGG - Intronic
1040027672 8:42796658-42796680 CCGAGCCGACGCCCACCTGTGGG - Intergenic
1049643974 8:143727891-143727913 CCGAGCCGTGGCGCACCTCGCGG + Exonic
1053218517 9:36292643-36292665 CCGAGCCAAGTCCCCCTTGAAGG - Intronic
1053603319 9:39632114-39632136 CCGGGGAGAGGCCCACCTGGCGG + Intergenic
1053860953 9:42385833-42385855 CCGGGGAGAGGCCCACCTGGCGG + Intergenic
1054564327 9:66744839-66744861 CCGGGGAGAGGCCCACCTGGCGG - Intergenic
1057605597 9:96496132-96496154 TCAGGCCGAGGCCCACCTAAAGG + Intronic
1062331438 9:136046546-136046568 CCGAGCCAGCGTCCACCTGATGG + Intronic
1185483159 X:463208-463230 CCGTGCCGAGACGCTCCTGAAGG + Intergenic
1188166941 X:26873831-26873853 CCGAGCCCTGCCCCACCTGAAGG + Intergenic
1190936515 X:55003079-55003101 CCGAGCAGAAGCCCTCCTGGCGG + Exonic
1199783478 X:151083604-151083626 CAGAACAGAGACCCACCTGAGGG - Intergenic
1202197129 Y:22307609-22307631 CCGAGCCCAGCTCCACGTGAAGG + Intergenic