ID: 990308632

View in Genome Browser
Species Human (GRCh38)
Location 5:54517891-54517913
Sequence CCCGAGCCGAGGCCCACCTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 146}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990308632_990308640 4 Left 990308632 5:54517891-54517913 CCTCAGGTGGGCCTCGGCTCGGG 0: 1
1: 0
2: 3
3: 10
4: 146
Right 990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG 0: 1
1: 0
2: 0
3: 0
4: 33
990308632_990308641 5 Left 990308632 5:54517891-54517913 CCTCAGGTGGGCCTCGGCTCGGG 0: 1
1: 0
2: 3
3: 10
4: 146
Right 990308641 5:54517919-54517941 GGGAGTCGGGACCGCCAGTCGGG 0: 1
1: 0
2: 0
3: 2
4: 49
990308632_990308647 20 Left 990308632 5:54517891-54517913 CCTCAGGTGGGCCTCGGCTCGGG 0: 1
1: 0
2: 3
3: 10
4: 146
Right 990308647 5:54517934-54517956 CAGTCGGGGCGCCGGGACCATGG 0: 1
1: 0
2: 2
3: 9
4: 150
990308632_990308637 -9 Left 990308632 5:54517891-54517913 CCTCAGGTGGGCCTCGGCTCGGG 0: 1
1: 0
2: 3
3: 10
4: 146
Right 990308637 5:54517905-54517927 CGGCTCGGGACGCCGGGAGTCGG 0: 1
1: 0
2: 2
3: 7
4: 74
990308632_990308643 12 Left 990308632 5:54517891-54517913 CCTCAGGTGGGCCTCGGCTCGGG 0: 1
1: 0
2: 3
3: 10
4: 146
Right 990308643 5:54517926-54517948 GGGACCGCCAGTCGGGGCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 97
990308632_990308644 13 Left 990308632 5:54517891-54517913 CCTCAGGTGGGCCTCGGCTCGGG 0: 1
1: 0
2: 3
3: 10
4: 146
Right 990308644 5:54517927-54517949 GGACCGCCAGTCGGGGCGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 76
990308632_990308638 -8 Left 990308632 5:54517891-54517913 CCTCAGGTGGGCCTCGGCTCGGG 0: 1
1: 0
2: 3
3: 10
4: 146
Right 990308638 5:54517906-54517928 GGCTCGGGACGCCGGGAGTCGGG 0: 1
1: 0
2: 0
3: 13
4: 118
990308632_990308642 6 Left 990308632 5:54517891-54517913 CCTCAGGTGGGCCTCGGCTCGGG 0: 1
1: 0
2: 3
3: 10
4: 146
Right 990308642 5:54517920-54517942 GGAGTCGGGACCGCCAGTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990308632 Original CRISPR CCCGAGCCGAGGCCCACCTG AGG (reversed) Exonic
900155353 1:1201538-1201560 TCCGCGCCGAGGCCCACGCGAGG + Intergenic
900517044 1:3087257-3087279 CCTGAGACCAGCCCCACCTGAGG + Intronic
901204925 1:7489156-7489178 CCCAGGCCAGGGCCCACCTGTGG - Intronic
901404550 1:9037773-9037795 TACGGGCCGAGGCCCTCCTGCGG + Exonic
901664984 1:10820761-10820783 CCCCAGCCCAGGCCAAGCTGCGG - Intergenic
904267343 1:29325482-29325504 CCCGAGCCCAGGCCCGCCCTCGG - Intronic
905596832 1:39214839-39214861 CCTGAGAAGAGGCACACCTGAGG + Intronic
907069206 1:51519006-51519028 CCGGAGCCGGAGCCCCCCTGCGG - Intronic
908561414 1:65310001-65310023 CCCGGCCCGAGGCCCCCCCGTGG + Intronic
912385258 1:109268275-109268297 CCAGAGCAGAGGCCTGCCTGTGG + Intronic
915287582 1:154862688-154862710 CCTGATCCCAGGCCAACCTGGGG + Intronic
915635652 1:157184731-157184753 CCCCAGCTGAGGCCAAGCTGGGG - Intergenic
918971084 1:191420309-191420331 CACAAGCAGAGGCACACCTGGGG + Intergenic
921383937 1:214551359-214551381 TCCGAGCAGAGGCGCACCGGGGG + Intronic
922762494 1:228141483-228141505 CCAGAGCCCAGGCCCACGTCTGG + Intronic
924710686 1:246527876-246527898 CACGTGCCCAGGCCCAGCTGGGG - Intergenic
1063087414 10:2832242-2832264 CACGAGCTAAGGACCACCTGGGG - Intergenic
1067431795 10:46250206-46250228 CCAGAGCTGAGGCACCCCTGTGG + Intergenic
1067441630 10:46311972-46311994 CCAGAGCTGAGGCACCCCTGTGG - Intronic
1072579108 10:96724516-96724538 CCCGAGCAGGGGCCCACAGGTGG - Intergenic
1076728300 10:132424062-132424084 CCCAAGCCGAGCCTCCCCTGGGG - Intergenic
1076776417 10:132700348-132700370 CCTGGGCCGAGGCCTCCCTGTGG + Intronic
1076821851 10:132943425-132943447 CTCTAGGGGAGGCCCACCTGGGG + Intergenic
1076861367 10:133139755-133139777 CTGGAGCCGAGGCCCCGCTGTGG - Intergenic
1077081423 11:726199-726221 CCCGGGCCCAGGGCCACCTGGGG + Intronic
1077457282 11:2688682-2688704 CACGTGCCTAGGCCCAGCTGGGG + Intronic
1080730109 11:34941862-34941884 CCAGAGCAGAGGCCCACCCGGGG - Intronic
1081506413 11:43721668-43721690 CCCAAGCCCAGGCCCACCCATGG - Intronic
1081634562 11:44712234-44712256 CCCAAGCCGAGGCCCAGATGCGG + Intergenic
1085519531 11:77129978-77130000 CCCGGGCCCAGGCCCAGGTGCGG + Intronic
1089442715 11:118530575-118530597 CCCGAGCCCCAGCCCACCTGCGG - Intronic
1090024463 11:123155898-123155920 CCCAAGGGGAGGCCCACATGGGG + Intronic
1101904497 12:108814697-108814719 CAGGAGCCACGGCCCACCTGTGG - Intronic
1104028767 12:125049193-125049215 CCGGCGCGGTGGCCCACCTGAGG - Intergenic
1104138115 12:125959741-125959763 CACAAGCCGAGGAACACCTGTGG + Intergenic
1104795611 12:131514957-131514979 CTAGAGCCAAGGCCAACCTGAGG + Intergenic
1104983429 12:132583701-132583723 CCCGGCCCGAGGCCCCCCAGCGG - Exonic
1108648624 13:52454429-52454451 CCACAGCCGAGGGCCAGCTGTGG + Intergenic
1110174204 13:72536733-72536755 CCAGAGGCGATGCCCTCCTGTGG - Intergenic
1112208201 13:97346744-97346766 CCTGAGCCCAGGCGCCCCTGCGG - Intronic
1113254737 13:108495272-108495294 CTGGAGCCGAGGTCCCCCTGGGG - Intergenic
1113730522 13:112638136-112638158 CCTGAGCTGATGGCCACCTGAGG + Intergenic
1116997044 14:51335254-51335276 CCCAAGCCCACTCCCACCTGAGG - Intergenic
1118611373 14:67542930-67542952 CCTGAGGCGAGGATCACCTGAGG - Intronic
1119699292 14:76742174-76742196 CCCATGGAGAGGCCCACCTGGGG - Intergenic
1121687195 14:95845316-95845338 CCCCAGCCCAGGCCCCACTGTGG + Intergenic
1122397146 14:101441717-101441739 CCCCAGCTGACGCCCATCTGCGG + Intergenic
1122982120 14:105196622-105196644 TCCGAGCCGAGGCCCAGACGAGG - Intergenic
1123042076 14:105494394-105494416 CCCAAGGCCAGGCCCACATGGGG + Intronic
1128252798 15:66174668-66174690 GCCCAGCCCAGCCCCACCTGTGG + Intronic
1132212608 15:100035618-100035640 CCCGAGACTCGGCACACCTGAGG - Intronic
1132426856 15:101724668-101724690 CCTGAGGCCAGGCCCACCTTAGG + Intergenic
1132693832 16:1193381-1193403 CAGGAGCCGAGGCCCTGCTGTGG - Intronic
1136378154 16:29877389-29877411 CCCGAGTCTTGGCCCAGCTGCGG - Exonic
1136428354 16:30183755-30183777 GCCGGGGCGAGGGCCACCTGTGG + Intronic
1141223051 16:82089708-82089730 CCCAAGCCAAGGCACACCTAGGG - Intronic
1141947087 16:87317774-87317796 CACGATTCGAGCCCCACCTGAGG - Intronic
1142103011 16:88285563-88285585 CAGGACCCGAGGCCCACCTGTGG + Intergenic
1142350207 16:89576186-89576208 CCCGAGCTGAGCCCCAGCTCCGG - Intronic
1143586760 17:7854331-7854353 CCCGACCCCAGCCCCACCTGAGG + Exonic
1144628536 17:16857869-16857891 CCCCTGCCAAGTCCCACCTGGGG + Intergenic
1144948457 17:18981672-18981694 CCCCATCTGATGCCCACCTGTGG + Intronic
1145160123 17:20568440-20568462 CCCCTGCCAAGTCCCACCTGGGG + Intergenic
1145242075 17:21245895-21245917 CCCTGGCCAAGGCCCAGCTGTGG + Intronic
1148793724 17:50187428-50187450 CCCAAGCCCAGGCTCACCTCGGG - Intronic
1149988488 17:61366715-61366737 CCCAAGAAGAGGCCCACCTTAGG - Intronic
1151476419 17:74346532-74346554 CCAGTGCCCAGGCCCAGCTGTGG - Intronic
1151546185 17:74794635-74794657 CCCCAGCCCAGACGCACCTGGGG + Intronic
1151958633 17:77393256-77393278 CCCCAGCCTTGTCCCACCTGGGG + Intronic
1152317428 17:79589250-79589272 CCCCAGAAGAAGCCCACCTGCGG - Intergenic
1152631454 17:81412504-81412526 CCCCAGCCGCCTCCCACCTGAGG - Intronic
1155381078 18:25223386-25223408 CCCTGGCGGAGGCCCCCCTGTGG - Intronic
1160498202 18:79387421-79387443 CACGAGCCAAGGAGCACCTGGGG - Intergenic
1160910216 19:1470622-1470644 CCCCAGCCTCGCCCCACCTGCGG - Exonic
1161284982 19:3464177-3464199 CCCGACGCGGGGCCCAGCTGCGG + Intronic
1161961375 19:7525188-7525210 CCCCAGCTGAAGGCCACCTGTGG + Intronic
1162363115 19:10231259-10231281 CCCCAGCCGCGGCCGCCCTGGGG - Exonic
1164693362 19:30226628-30226650 CCCAGGCCGAGGCCCGGCTGGGG - Intergenic
1165808610 19:38596891-38596913 CCCGAGGCCCCGCCCACCTGCGG - Intronic
1166088092 19:40490069-40490091 CCCTAGCCCAGGCCCACGCGCGG + Exonic
1166876835 19:45902584-45902606 CCCGAGCCCTGACCCACCGGCGG - Exonic
925180683 2:1815221-1815243 CCCGAGGTGAGGCCCCTCTGCGG + Intronic
929247445 2:39718416-39718438 CTCAAGCCTAGGCCCAGCTGTGG - Intergenic
937134992 2:119544609-119544631 CCCAAGCCGCGGCCGACTTGCGG - Intronic
937839304 2:126509747-126509769 CCCCATCTGAGGCTCACCTGTGG + Intergenic
938467556 2:131533263-131533285 CCCCAGCCTGAGCCCACCTGTGG + Exonic
942346108 2:175004845-175004867 CCCGGGACGCGGCCCACCTGCGG + Intronic
947714494 2:232332868-232332890 CTCCAGCCTAGGCCCACCTTTGG - Intronic
948504869 2:238421953-238421975 CACAAGCCGAGGAACACCTGGGG - Intergenic
1169057564 20:2635967-2635989 CCCGAGCTAATGCCCAGCTGAGG + Exonic
1169321961 20:4640509-4640531 CCTGAGCCTAGGCCCACCTGGGG - Intergenic
1173579554 20:44137414-44137436 CCCCAGCCGAGCCCCACCTGGGG - Intronic
1174305103 20:49609488-49609510 CCTGAGCCCAGGCTCAGCTGTGG + Intergenic
1174581474 20:51575005-51575027 CCTGAGGAGAGGCCCACATGGGG - Intergenic
1175917113 20:62431254-62431276 CCCAAGCAGCGGCTCACCTGGGG - Intergenic
1176180778 20:63748379-63748401 CCTCAGCGGAAGCCCACCTGGGG - Intronic
1178985471 21:37299129-37299151 CCCCTCCCGAGGCCCAGCTGAGG + Intergenic
1180625415 22:17190700-17190722 CCAGAGCCTAGGCAAACCTGGGG + Intronic
1181407883 22:22697791-22697813 TCTGAGCCCAGGCCCACGTGAGG + Intergenic
1182273373 22:29169887-29169909 CCCCAGAGCAGGCCCACCTGTGG - Intergenic
1183338927 22:37267301-37267323 CCAGAGCCGAGGCCCACAGGAGG - Intergenic
1184145718 22:42609141-42609163 CCAGAGCCGAGGCCCCCCCAGGG - Intronic
1184187834 22:42876549-42876571 CCACAGCAGAGGCCAACCTGGGG + Intronic
1185082046 22:48714894-48714916 CACGAGCCAAGGAACACCTGGGG - Intronic
1185419807 22:50728964-50728986 CCTGTGCTGAGGCCCACCTCAGG + Intergenic
950251412 3:11468709-11468731 CCCCATCCCAAGCCCACCTGTGG - Intronic
954674245 3:52306972-52306994 CAGGAGCCAAGGCCCAACTGGGG + Intergenic
955365570 3:58307078-58307100 CTAGAGCCGAGGCCCAGCGGTGG + Intronic
956659403 3:71583339-71583361 CCCGGGTCGAGGCCCAGCTCTGG - Intronic
961652095 3:128421754-128421776 CCTGAGCCTCGGCCCACCTCTGG + Intergenic
968647698 4:1748670-1748692 CCCGAGCCCAGGCCTTCCTTGGG + Intergenic
968896952 4:3409853-3409875 GCCTAGGCGAGGCCCAGCTGAGG - Intronic
969672184 4:8595920-8595942 CACGAGCCAAGGAGCACCTGGGG + Intronic
972292788 4:37705399-37705421 CCCAAGCCAAGGAACACCTGGGG - Intergenic
976608619 4:87006785-87006807 CCCCGGCCGAGCCCCGCCTGCGG - Intronic
977908411 4:102502102-102502124 CCCAACCCCAGCCCCACCTGGGG + Intronic
981223105 4:142259838-142259860 CCTTAGCCTAGGCCCACATGGGG + Intronic
984838017 4:184040337-184040359 CTCCAGCCGCGGTCCACCTGGGG + Intergenic
985650352 5:1104657-1104679 ACAGAGCCGAGGCCCACCGGGGG + Intronic
985665343 5:1179236-1179258 CCCCAGCTGAGCCTCACCTGAGG - Intergenic
986506586 5:8457957-8457979 CCCGCGCAGAGGCCGACGTGGGG - Intergenic
987099831 5:14581953-14581975 CCCGGCCCCAGGCTCACCTGCGG - Exonic
990003817 5:50922857-50922879 CCGGAGCCGCAGCCCACTTGGGG + Intergenic
990308632 5:54517891-54517913 CCCGAGCCGAGGCCCACCTGAGG - Exonic
996536336 5:124581623-124581645 GCCGTGCAGAGGCCCAGCTGTGG - Intergenic
1002400104 5:178986797-178986819 CCTGGGCCCATGCCCACCTGGGG + Intronic
1004033773 6:11901167-11901189 CCAGAGCAGAGACTCACCTGTGG - Intergenic
1004203982 6:13574619-13574641 CCTGAGCCACGGCTCACCTGGGG - Intronic
1006830280 6:36964155-36964177 CCAGAGCCAAGGCACTCCTGGGG - Intronic
1007706377 6:43793816-43793838 CCCCAGCAGATGCCCTCCTGAGG + Intergenic
1013488534 6:110621236-110621258 CCCGGCCCCAGCCCCACCTGCGG + Exonic
1015935760 6:138404592-138404614 CCCGAGTCGGCGCCTACCTGGGG - Exonic
1018921542 6:168179336-168179358 ACTGAGGCGAGGACCACCTGCGG + Intergenic
1018921554 6:168179385-168179407 GCTGAGGCGAGGACCACCTGTGG + Intergenic
1020000261 7:4751623-4751645 CCGTGGCCGAGGCCCGCCTGCGG + Intronic
1023173975 7:37417929-37417951 CACAAGCCAAGGACCACCTGGGG + Intronic
1026841256 7:73671081-73671103 GCCGCGCCCTGGCCCACCTGAGG + Exonic
1026975309 7:74494329-74494351 CCTGAGCCGAGGAACAGCTGGGG + Intronic
1029207609 7:98878771-98878793 CCCCAGCCAGAGCCCACCTGGGG + Intronic
1033429867 7:141279676-141279698 CCCTAGCAGAACCCCACCTGAGG - Intronic
1034429375 7:151033637-151033659 TCCGGGCCGTGGCCCACCTGCGG + Exonic
1034902616 7:154916639-154916661 CCCGAGCCGGGACTCTCCTGGGG - Intergenic
1034999664 7:155602926-155602948 CCCGAGCGCAGCCTCACCTGGGG - Intergenic
1035259356 7:157651929-157651951 GCTGAGTCGAGGCTCACCTGCGG - Intronic
1040027674 8:42796659-42796681 GCCGAGCCGACGCCCACCTGTGG - Intergenic
1040284874 8:46094552-46094574 CCCCTGCACAGGCCCACCTGTGG - Intergenic
1045459437 8:102412908-102412930 CCCGAGCCCAGCCCCGCCGGGGG + Intergenic
1048967475 8:139625114-139625136 TCTGAGCCGAGCCCCACCTCAGG + Intronic
1049544183 8:143221815-143221837 CCCCAGCCGAGGGCGACCCGAGG + Intergenic
1049639474 8:143708213-143708235 CCCGAGGCGCGTCCCACCTCTGG - Intronic
1049709478 8:144057191-144057213 CCCACACCCAGGCCCACCTGTGG + Exonic
1050112771 9:2233827-2233849 CCTGAGCCCAAGCCCGCCTGAGG - Intergenic
1056369735 9:85941600-85941622 CTAGGGCCGAGGCACACCTGAGG - Intronic
1056381013 9:86057506-86057528 CCCGAGCCGGGGTGCAGCTGAGG + Intronic
1058750686 9:108035808-108035830 ACAGGGCCGAGGCCCAGCTGGGG + Intergenic
1060523775 9:124309103-124309125 CCTGAGCAGAGGCCACCCTGGGG + Intronic
1061290034 9:129645451-129645473 CCCAAGCCGAGGTACCCCTGTGG - Intergenic
1062013395 9:134278844-134278866 CCACAGCCGAGGTCCAGCTGGGG - Intergenic
1189245292 X:39558647-39558669 CCACAGCCGAGGAACACCTGGGG + Intergenic
1199783479 X:151083605-151083627 CCAGAACAGAGACCCACCTGAGG - Intergenic