ID: 990308636

View in Genome Browser
Species Human (GRCh38)
Location 5:54517902-54517924
Sequence ACTCCCGGCGTCCCGAGCCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 53}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990308636_990308647 9 Left 990308636 5:54517902-54517924 CCTCGGCTCGGGACGCCGGGAGT 0: 1
1: 0
2: 0
3: 4
4: 53
Right 990308647 5:54517934-54517956 CAGTCGGGGCGCCGGGACCATGG 0: 1
1: 0
2: 2
3: 9
4: 150
990308636_990308644 2 Left 990308636 5:54517902-54517924 CCTCGGCTCGGGACGCCGGGAGT 0: 1
1: 0
2: 0
3: 4
4: 53
Right 990308644 5:54517927-54517949 GGACCGCCAGTCGGGGCGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 76
990308636_990308650 24 Left 990308636 5:54517902-54517924 CCTCGGCTCGGGACGCCGGGAGT 0: 1
1: 0
2: 0
3: 4
4: 53
Right 990308650 5:54517949-54517971 GACCATGGCGCTGCGCGCCCGGG 0: 1
1: 0
2: 0
3: 7
4: 86
990308636_990308649 23 Left 990308636 5:54517902-54517924 CCTCGGCTCGGGACGCCGGGAGT 0: 1
1: 0
2: 0
3: 4
4: 53
Right 990308649 5:54517948-54517970 GGACCATGGCGCTGCGCGCCCGG 0: 1
1: 0
2: 1
3: 7
4: 87
990308636_990308640 -7 Left 990308636 5:54517902-54517924 CCTCGGCTCGGGACGCCGGGAGT 0: 1
1: 0
2: 0
3: 4
4: 53
Right 990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG 0: 1
1: 0
2: 0
3: 0
4: 33
990308636_990308642 -5 Left 990308636 5:54517902-54517924 CCTCGGCTCGGGACGCCGGGAGT 0: 1
1: 0
2: 0
3: 4
4: 53
Right 990308642 5:54517920-54517942 GGAGTCGGGACCGCCAGTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 38
990308636_990308641 -6 Left 990308636 5:54517902-54517924 CCTCGGCTCGGGACGCCGGGAGT 0: 1
1: 0
2: 0
3: 4
4: 53
Right 990308641 5:54517919-54517941 GGGAGTCGGGACCGCCAGTCGGG 0: 1
1: 0
2: 0
3: 2
4: 49
990308636_990308643 1 Left 990308636 5:54517902-54517924 CCTCGGCTCGGGACGCCGGGAGT 0: 1
1: 0
2: 0
3: 4
4: 53
Right 990308643 5:54517926-54517948 GGGACCGCCAGTCGGGGCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990308636 Original CRISPR ACTCCCGGCGTCCCGAGCCG AGG (reversed) Exonic
901068570 1:6506213-6506235 ACTCCCTGCGTCCCGTCCCCAGG - Intronic
910138402 1:83999090-83999112 AGCACCGGAGTCCCGAGCCGTGG - Exonic
924043074 1:240002727-240002749 ACTCCCAGCATGCCGAGCCCAGG - Intergenic
1063955115 10:11258398-11258420 ACTCCTGGAGTCCTGAGCCAGGG + Intronic
1072938100 10:99732451-99732473 ACTCCCGCCGGCCCGCCCCGGGG - Intronic
1073076225 10:100827159-100827181 ACTCCCGGCGACCCGACCTCTGG + Intronic
1073578007 10:104641292-104641314 ACACTCGGCAGCCCGAGCCGCGG + Exonic
1083743652 11:64723582-64723604 TCTCGCGGCGTCCCAAGTCGGGG - Intergenic
1084204417 11:67583690-67583712 ACTCCCGCCGGCCCCAGCCCCGG - Exonic
1089262533 11:117232624-117232646 ACTTCCGGCGGCACGAGCGGAGG - Exonic
1089533859 11:119149223-119149245 GGTCCCGGCGGCCCGGGCCGGGG - Exonic
1096544525 12:52328383-52328405 ACTCACAGCGTCCGGAGCAGTGG - Intergenic
1096691555 12:53325090-53325112 GAGCCCGGCGTCCCGACCCGGGG + Intergenic
1101813680 12:108129503-108129525 ACTGCGGGTGCCCCGAGCCGCGG - Intronic
1107065892 13:36214291-36214313 TCCCCCGGCGCCCCGAGCTGGGG - Intronic
1124612068 15:31215752-31215774 GCCCCCGCCGCCCCGAGCCGTGG + Intergenic
1125182009 15:36888427-36888449 ACTCAGGGCGTCGCGCGCCGGGG - Intergenic
1129775772 15:78235366-78235388 ACTTCTGGCCTCCAGAGCCGTGG - Intronic
1131315565 15:91333790-91333812 ACTCCCGGCCTCCAGAACTGTGG + Intergenic
1132490792 16:229451-229473 CCTCCCGGCGTCCCCCGCGGCGG - Intronic
1132559959 16:589144-589166 GCTCCCCGCGTCCCGAGCTGTGG + Intergenic
1151946007 17:77320276-77320298 AGTCCCGGCGTCCCGCTCAGAGG - Intronic
1160952032 19:1672245-1672267 ACCCCTGGCGTCCCGAGCGGGGG - Intergenic
1161978941 19:7620677-7620699 ACTCCCGGCCTCCCCAACCCCGG - Intronic
1166753894 19:45179024-45179046 GTTCCCGGAGTCCCAAGCCGAGG - Intronic
936935592 2:117836077-117836099 GCTCCCGGCGTCTCCAGCAGAGG + Intergenic
938368846 2:130756272-130756294 GCTCCCGGCGCCGCGCGCCGCGG - Exonic
947592986 2:231395730-231395752 CGTCCCGCCGGCCCGAGCCGTGG + Exonic
948467506 2:238159250-238159272 CCTCCCGCCGCCCCGAGCCGGGG - Intronic
1179910591 21:44445594-44445616 TCTCCCGGCGCCCAGAGCAGCGG + Intergenic
1180177609 21:46098132-46098154 GCTCCCGACGGCCCGAGGCGCGG - Exonic
963939851 3:151086975-151086997 ACGTCGGGCGGCCCGAGCCGGGG - Exonic
969627943 4:8317183-8317205 ACTCCTGTCGTCCCTGGCCGAGG + Intergenic
973668787 4:53192008-53192030 ACTCCCAGAGTCCAGAGCTGGGG - Intronic
982198178 4:152936444-152936466 GCTCCCCGTGTCCCGCGCCGCGG - Intronic
985580437 5:693099-693121 ACTCCGGGCATCCCAATCCGGGG + Intronic
985595099 5:784489-784511 ACTCCGGGCATCCCAATCCGGGG + Intergenic
985863914 5:2496396-2496418 ACTCCCAGCTTCCAGAGCCCTGG + Intergenic
986016339 5:3760824-3760846 ACTCCAGGCGTGGGGAGCCGTGG + Intergenic
987108711 5:14664905-14664927 CTTCCCGCCGTCCCGCGCCGTGG - Exonic
990308636 5:54517902-54517924 ACTCCCGGCGTCCCGAGCCGAGG - Exonic
1001437863 5:171714594-171714616 ACTCCCAGAGGCCCAAGCCGGGG + Intergenic
1007834363 6:44663430-44663452 ACTCCCAGCGCCCAGAGCAGTGG - Intergenic
1026829604 7:73602857-73602879 ACTCCCTGGGTCCCGGGCAGGGG + Intronic
1029849520 7:103447363-103447385 ACTCTCCGCGTCCCTAGCTGAGG + Intergenic
1034466431 7:151232637-151232659 TCTCCCGGCGTCCCGGGAGGGGG - Exonic
1035197873 7:157238266-157238288 ACTCCTGGCGTCACCAGCAGAGG + Intronic
1037928926 8:22865784-22865806 ACTCCCGGGGGCGCGAGCGGCGG + Intronic
1040065483 8:43140925-43140947 GGTCCCGGCGTCCCGATCCGCGG - Intronic
1042877045 8:73449244-73449266 ACTTCCGGCCTCCAGAGCCCAGG - Intronic
1049321423 8:141998918-141998940 ACTTCCAGCCTCCAGAGCCGAGG - Intergenic
1059769851 9:117414884-117414906 GCCCCCGGAGCCCCGAGCCGGGG + Exonic
1061075719 9:128340453-128340475 ACTCCCAGCGTGCCGCGCGGCGG + Intergenic
1061638871 9:131935699-131935721 AGTCCCTGCCTCCCGACCCGTGG - Intronic
1061876343 9:133546117-133546139 CCTCCCTGCGTCCCCAGCCCTGG + Intronic
1062551026 9:137086557-137086579 AGTCCCAGCGTCCCGCGCCTCGG - Intergenic
1187143060 X:16613038-16613060 ACTTCCAGAGTCCCGAGCAGAGG - Intronic
1196735151 X:118976128-118976150 ACACCCGGCGGCGCGAGCGGCGG - Intronic