ID: 990308636

View in Genome Browser
Species Human (GRCh38)
Location 5:54517902-54517924
Sequence ACTCCCGGCGTCCCGAGCCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 53}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990308636_990308647 9 Left 990308636 5:54517902-54517924 CCTCGGCTCGGGACGCCGGGAGT 0: 1
1: 0
2: 0
3: 4
4: 53
Right 990308647 5:54517934-54517956 CAGTCGGGGCGCCGGGACCATGG 0: 1
1: 0
2: 2
3: 9
4: 150
990308636_990308644 2 Left 990308636 5:54517902-54517924 CCTCGGCTCGGGACGCCGGGAGT 0: 1
1: 0
2: 0
3: 4
4: 53
Right 990308644 5:54517927-54517949 GGACCGCCAGTCGGGGCGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 76
990308636_990308642 -5 Left 990308636 5:54517902-54517924 CCTCGGCTCGGGACGCCGGGAGT 0: 1
1: 0
2: 0
3: 4
4: 53
Right 990308642 5:54517920-54517942 GGAGTCGGGACCGCCAGTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 38
990308636_990308649 23 Left 990308636 5:54517902-54517924 CCTCGGCTCGGGACGCCGGGAGT 0: 1
1: 0
2: 0
3: 4
4: 53
Right 990308649 5:54517948-54517970 GGACCATGGCGCTGCGCGCCCGG 0: 1
1: 0
2: 1
3: 7
4: 87
990308636_990308640 -7 Left 990308636 5:54517902-54517924 CCTCGGCTCGGGACGCCGGGAGT 0: 1
1: 0
2: 0
3: 4
4: 53
Right 990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG 0: 1
1: 0
2: 0
3: 0
4: 33
990308636_990308643 1 Left 990308636 5:54517902-54517924 CCTCGGCTCGGGACGCCGGGAGT 0: 1
1: 0
2: 0
3: 4
4: 53
Right 990308643 5:54517926-54517948 GGGACCGCCAGTCGGGGCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 97
990308636_990308650 24 Left 990308636 5:54517902-54517924 CCTCGGCTCGGGACGCCGGGAGT 0: 1
1: 0
2: 0
3: 4
4: 53
Right 990308650 5:54517949-54517971 GACCATGGCGCTGCGCGCCCGGG 0: 1
1: 0
2: 0
3: 7
4: 86
990308636_990308641 -6 Left 990308636 5:54517902-54517924 CCTCGGCTCGGGACGCCGGGAGT 0: 1
1: 0
2: 0
3: 4
4: 53
Right 990308641 5:54517919-54517941 GGGAGTCGGGACCGCCAGTCGGG 0: 1
1: 0
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990308636 Original CRISPR ACTCCCGGCGTCCCGAGCCG AGG (reversed) Exonic