ID: 990308640

View in Genome Browser
Species Human (GRCh38)
Location 5:54517918-54517940
Sequence CGGGAGTCGGGACCGCCAGT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 33}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990308636_990308640 -7 Left 990308636 5:54517902-54517924 CCTCGGCTCGGGACGCCGGGAGT 0: 1
1: 0
2: 0
3: 4
4: 53
Right 990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG 0: 1
1: 0
2: 0
3: 0
4: 33
990308627_990308640 13 Left 990308627 5:54517882-54517904 CCGCGGGCCCCTCAGGTGGGCCT 0: 1
1: 0
2: 2
3: 22
4: 249
Right 990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG 0: 1
1: 0
2: 0
3: 0
4: 33
990308632_990308640 4 Left 990308632 5:54517891-54517913 CCTCAGGTGGGCCTCGGCTCGGG 0: 1
1: 0
2: 3
3: 10
4: 146
Right 990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG 0: 1
1: 0
2: 0
3: 0
4: 33
990308630_990308640 5 Left 990308630 5:54517890-54517912 CCCTCAGGTGGGCCTCGGCTCGG 0: 1
1: 0
2: 1
3: 12
4: 112
Right 990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG 0: 1
1: 0
2: 0
3: 0
4: 33
990308621_990308640 30 Left 990308621 5:54517865-54517887 CCAGGGCTCGAGCAGTACCGCGG 0: 1
1: 0
2: 0
3: 10
4: 171
Right 990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG 0: 1
1: 0
2: 0
3: 0
4: 33
990308629_990308640 6 Left 990308629 5:54517889-54517911 CCCCTCAGGTGGGCCTCGGCTCG 0: 1
1: 0
2: 1
3: 3
4: 82
Right 990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG 0: 1
1: 0
2: 0
3: 0
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990308640 Original CRISPR CGGGAGTCGGGACCGCCAGT CGG Exonic
903016684 1:20366321-20366343 CGGGAGTGGGGACCGACGGGCGG - Intergenic
903241805 1:21987624-21987646 TGGGAGTGGGGACCACCAGGTGG + Intronic
903245313 1:22010793-22010815 TGGGAGTGGGGACCACCAGGTGG + Intronic
915393395 1:155563377-155563399 CGGGACTCCGGACCTCCAGGAGG + Intergenic
915409518 1:155689222-155689244 CGGGACTCCGGACCTCCAGGAGG + Intronic
922335837 1:224617487-224617509 CGGGACCCGGGACGCCCAGTCGG - Intronic
1072021861 10:91410409-91410431 CGGGCGGCGGGAGCGCCAGGCGG - Exonic
1072619657 10:97071333-97071355 AGGAAGGCGGGACCTCCAGTGGG + Intronic
1076781326 10:132726369-132726391 CGGGAGGAGGGACCGACAGCGGG - Intronic
1082009216 11:47438942-47438964 CAGGAGTGGAGAGCGCCAGTGGG + Intronic
1084118584 11:67056143-67056165 CGGGAGTAGGGACAGGCAGCGGG - Intergenic
1105871939 13:24512883-24512905 CCGGAATCGGGTCCGCCAGGTGG + Intergenic
1121796638 14:96741506-96741528 CGGGTGTCGGCACCAGCAGTGGG - Intergenic
1122982190 14:105196862-105196884 CGGGACTCGGGACCGCAGGCCGG + Intergenic
1162914272 19:13865715-13865737 CCGGAGCCGGGGCCGCCAGGGGG + Intronic
1167322640 19:48806069-48806091 CGGGAGAGGGGACAGCCATTGGG - Intronic
932699843 2:73985044-73985066 CGGGAGGCGGGAGCCCCAGGCGG + Intergenic
949041565 2:241852136-241852158 CGGGAGTGAGGGCCGCCAGCAGG + Intronic
1171430179 20:25078057-25078079 CGTGAGTCCGGACCGCACGTGGG - Intronic
1178073327 21:28992951-28992973 CGGGAGGCGGGAGCGGAAGTGGG - Exonic
1181987251 22:26808786-26808808 TGGGAGACAGGACAGCCAGTTGG - Intergenic
952816529 3:37452226-37452248 CGGGCGTCGGGCCCGCCACCGGG - Exonic
961770920 3:129249479-129249501 CGGGAGTGGGGAAAGCCAGACGG - Intergenic
968812613 4:2806748-2806770 TGGGAGTCGGGACTGCCCGGGGG - Intronic
973737399 4:53885902-53885924 CTGGAGTCTGGACTGGCAGTGGG + Intronic
978529953 4:109703109-109703131 CGCTACTCGGGACCGCCAGGAGG + Intronic
990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG + Exonic
999140429 5:149357969-149357991 AGGAAGGCGGGACTGCCAGTGGG + Intergenic
1005267448 6:24126755-24126777 CAGGAGTGGGGAGGGCCAGTGGG - Intronic
1006436497 6:34028405-34028427 CGGGAGTCAGGGCCCTCAGTCGG - Intronic
1029169103 7:98618126-98618148 CGCGCGTCGGGACTGCCAGCGGG + Intronic
1054798540 9:69325087-69325109 CGGGAGGCGGACCCGCCAGGCGG + Intronic
1187438114 X:19291161-19291183 CGGAAGTCGGGCCCACCAGATGG + Intergenic
1199760225 X:150899028-150899050 CGGGAGGCGGCAGCGCCGGTGGG + Intergenic