ID: 990308640

View in Genome Browser
Species Human (GRCh38)
Location 5:54517918-54517940
Sequence CGGGAGTCGGGACCGCCAGT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 33}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990308627_990308640 13 Left 990308627 5:54517882-54517904 CCGCGGGCCCCTCAGGTGGGCCT 0: 1
1: 0
2: 2
3: 22
4: 249
Right 990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG 0: 1
1: 0
2: 0
3: 0
4: 33
990308629_990308640 6 Left 990308629 5:54517889-54517911 CCCCTCAGGTGGGCCTCGGCTCG 0: 1
1: 0
2: 1
3: 3
4: 82
Right 990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG 0: 1
1: 0
2: 0
3: 0
4: 33
990308632_990308640 4 Left 990308632 5:54517891-54517913 CCTCAGGTGGGCCTCGGCTCGGG 0: 1
1: 0
2: 3
3: 10
4: 146
Right 990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG 0: 1
1: 0
2: 0
3: 0
4: 33
990308636_990308640 -7 Left 990308636 5:54517902-54517924 CCTCGGCTCGGGACGCCGGGAGT 0: 1
1: 0
2: 0
3: 4
4: 53
Right 990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG 0: 1
1: 0
2: 0
3: 0
4: 33
990308630_990308640 5 Left 990308630 5:54517890-54517912 CCCTCAGGTGGGCCTCGGCTCGG 0: 1
1: 0
2: 1
3: 12
4: 112
Right 990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG 0: 1
1: 0
2: 0
3: 0
4: 33
990308621_990308640 30 Left 990308621 5:54517865-54517887 CCAGGGCTCGAGCAGTACCGCGG 0: 1
1: 0
2: 0
3: 10
4: 171
Right 990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG 0: 1
1: 0
2: 0
3: 0
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990308640 Original CRISPR CGGGAGTCGGGACCGCCAGT CGG Exonic