ID: 990308647

View in Genome Browser
Species Human (GRCh38)
Location 5:54517934-54517956
Sequence CAGTCGGGGCGCCGGGACCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 150}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990308630_990308647 21 Left 990308630 5:54517890-54517912 CCCTCAGGTGGGCCTCGGCTCGG 0: 1
1: 0
2: 1
3: 12
4: 112
Right 990308647 5:54517934-54517956 CAGTCGGGGCGCCGGGACCATGG 0: 1
1: 0
2: 2
3: 9
4: 150
990308639_990308647 -6 Left 990308639 5:54517917-54517939 CCGGGAGTCGGGACCGCCAGTCG 0: 1
1: 0
2: 0
3: 3
4: 42
Right 990308647 5:54517934-54517956 CAGTCGGGGCGCCGGGACCATGG 0: 1
1: 0
2: 2
3: 9
4: 150
990308627_990308647 29 Left 990308627 5:54517882-54517904 CCGCGGGCCCCTCAGGTGGGCCT 0: 1
1: 0
2: 2
3: 22
4: 249
Right 990308647 5:54517934-54517956 CAGTCGGGGCGCCGGGACCATGG 0: 1
1: 0
2: 2
3: 9
4: 150
990308636_990308647 9 Left 990308636 5:54517902-54517924 CCTCGGCTCGGGACGCCGGGAGT 0: 1
1: 0
2: 0
3: 4
4: 53
Right 990308647 5:54517934-54517956 CAGTCGGGGCGCCGGGACCATGG 0: 1
1: 0
2: 2
3: 9
4: 150
990308629_990308647 22 Left 990308629 5:54517889-54517911 CCCCTCAGGTGGGCCTCGGCTCG 0: 1
1: 0
2: 1
3: 3
4: 82
Right 990308647 5:54517934-54517956 CAGTCGGGGCGCCGGGACCATGG 0: 1
1: 0
2: 2
3: 9
4: 150
990308632_990308647 20 Left 990308632 5:54517891-54517913 CCTCAGGTGGGCCTCGGCTCGGG 0: 1
1: 0
2: 3
3: 10
4: 146
Right 990308647 5:54517934-54517956 CAGTCGGGGCGCCGGGACCATGG 0: 1
1: 0
2: 2
3: 9
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990308647 Original CRISPR CAGTCGGGGCGCCGGGACCA TGG Exonic