ID: 990308649

View in Genome Browser
Species Human (GRCh38)
Location 5:54517948-54517970
Sequence GGACCATGGCGCTGCGCGCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 87}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990308646_990308649 -8 Left 990308646 5:54517933-54517955 CCAGTCGGGGCGCCGGGACCATG 0: 1
1: 0
2: 0
3: 2
4: 44
Right 990308649 5:54517948-54517970 GGACCATGGCGCTGCGCGCCCGG 0: 1
1: 0
2: 1
3: 7
4: 87
990308639_990308649 8 Left 990308639 5:54517917-54517939 CCGGGAGTCGGGACCGCCAGTCG 0: 1
1: 0
2: 0
3: 3
4: 42
Right 990308649 5:54517948-54517970 GGACCATGGCGCTGCGCGCCCGG 0: 1
1: 0
2: 1
3: 7
4: 87
990308645_990308649 -5 Left 990308645 5:54517930-54517952 CCGCCAGTCGGGGCGCCGGGACC 0: 1
1: 0
2: 0
3: 9
4: 97
Right 990308649 5:54517948-54517970 GGACCATGGCGCTGCGCGCCCGG 0: 1
1: 0
2: 1
3: 7
4: 87
990308636_990308649 23 Left 990308636 5:54517902-54517924 CCTCGGCTCGGGACGCCGGGAGT 0: 1
1: 0
2: 0
3: 4
4: 53
Right 990308649 5:54517948-54517970 GGACCATGGCGCTGCGCGCCCGG 0: 1
1: 0
2: 1
3: 7
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990308649 Original CRISPR GGACCATGGCGCTGCGCGCC CGG Exonic