ID: 990308650

View in Genome Browser
Species Human (GRCh38)
Location 5:54517949-54517971
Sequence GACCATGGCGCTGCGCGCCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 86}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990308636_990308650 24 Left 990308636 5:54517902-54517924 CCTCGGCTCGGGACGCCGGGAGT 0: 1
1: 0
2: 0
3: 4
4: 53
Right 990308650 5:54517949-54517971 GACCATGGCGCTGCGCGCCCGGG 0: 1
1: 0
2: 0
3: 7
4: 86
990308645_990308650 -4 Left 990308645 5:54517930-54517952 CCGCCAGTCGGGGCGCCGGGACC 0: 1
1: 0
2: 0
3: 9
4: 97
Right 990308650 5:54517949-54517971 GACCATGGCGCTGCGCGCCCGGG 0: 1
1: 0
2: 0
3: 7
4: 86
990308639_990308650 9 Left 990308639 5:54517917-54517939 CCGGGAGTCGGGACCGCCAGTCG 0: 1
1: 0
2: 0
3: 3
4: 42
Right 990308650 5:54517949-54517971 GACCATGGCGCTGCGCGCCCGGG 0: 1
1: 0
2: 0
3: 7
4: 86
990308646_990308650 -7 Left 990308646 5:54517933-54517955 CCAGTCGGGGCGCCGGGACCATG 0: 1
1: 0
2: 0
3: 2
4: 44
Right 990308650 5:54517949-54517971 GACCATGGCGCTGCGCGCCCGGG 0: 1
1: 0
2: 0
3: 7
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990308650 Original CRISPR GACCATGGCGCTGCGCGCCC GGG Exonic