ID: 990310120

View in Genome Browser
Species Human (GRCh38)
Location 5:54529748-54529770
Sequence CCAAGGTTACACAGTGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 466
Summary {0: 1, 1: 0, 2: 7, 3: 63, 4: 395}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990310120_990310126 19 Left 990310120 5:54529748-54529770 CCAGCTTCACTGTGTAACCTTGG 0: 1
1: 0
2: 7
3: 63
4: 395
Right 990310126 5:54529790-54529812 CTGTTTCCTCATGTGTAACATGG 0: 1
1: 19
2: 300
3: 2259
4: 7710

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990310120 Original CRISPR CCAAGGTTACACAGTGAAGC TGG (reversed) Intronic
900124570 1:1063791-1063813 CCAGGGTGACTCAGGGAAGCCGG + Intergenic
902085311 1:13855777-13855799 CCCAGGCTGCACAGAGAAGCAGG - Intergenic
902174245 1:14637454-14637476 CCAAGGGCACACAGTGGAGAAGG + Intronic
902270018 1:15297124-15297146 CCAAGGTTGCACAGTAAAAGGGG + Intronic
902763559 1:18599878-18599900 CCAAGGTCACACAGCAAACCTGG + Intergenic
903382143 1:22904856-22904878 CCAAGGTCACACAGCTGAGCAGG + Intronic
903462621 1:23530254-23530276 CCAAGGTCACACAGTGCACTGGG + Intronic
903893199 1:26584078-26584100 CCAAGGTCACACAGTGCTGAAGG + Intergenic
904276532 1:29388368-29388390 CCAAGGTCACACAGTGACTGAGG + Intergenic
904356617 1:29944425-29944447 CCTAGGGTACACAGTGAGGCTGG - Intergenic
904798224 1:33073557-33073579 CCAAGGTCACACAGTAAATGAGG + Intronic
904923734 1:34029362-34029384 CCAAGGTCACCCAGTGAGTCAGG + Intronic
905434214 1:37945939-37945961 CCAAGGCCACACAGTGAATCTGG - Intronic
905912973 1:41666404-41666426 CCAAGGTGACACAGTAAATGTGG - Intronic
905941440 1:41866493-41866515 CCAAGGATTCACAGTGGACCTGG + Intronic
906082706 1:43104003-43104025 CCAAGGTTACACAGCTAATATGG + Intergenic
906145455 1:43557869-43557891 CCAAGGTTATACAGACCAGCAGG - Intronic
906926936 1:50127763-50127785 CCAAGGTCACACAGCTAAACAGG + Intronic
907187132 1:52618207-52618229 CCAAGGTTACACAGTGAGTAAGG - Intergenic
907321126 1:53603009-53603031 CCAAGGTCACACAGGGAAGAAGG + Intronic
908139655 1:61171094-61171116 CCAAGGTTACATAGCCAATCTGG - Intronic
908932313 1:69331754-69331776 CCAAGGCTGCACAGAGCAGCAGG + Intergenic
909023659 1:70460048-70460070 CCAAGGCTGCACAGAGGAGCAGG - Intergenic
910563583 1:88618736-88618758 CCAAGGTTGCACAGAGCAGTAGG + Intergenic
911127662 1:94355539-94355561 CCCATGTTACACAATGAAGGGGG - Intergenic
912074049 1:105850258-105850280 CCAAGGTTGCACAGTGCAGTAGG - Intergenic
912472999 1:109918510-109918532 CCAAGGTGGGACAGTGAAGGTGG + Intronic
913347089 1:117819831-117819853 CCAAGTTTGCATAGTAAAGCTGG - Intergenic
913683991 1:121214371-121214393 CCAAGGTCACACAGTTAATAGGG + Intronic
914905086 1:151737439-151737461 CCAAGGCTACGCAGGGCAGCAGG - Intergenic
915694170 1:157722169-157722191 CCAAGGCTGCACAGCGCAGCAGG + Intergenic
916198369 1:162246658-162246680 CCAGGGTTACAGAGTCAAGTAGG - Intronic
917696834 1:177533963-177533985 CCAAGGTTGCACAGGGGAGCAGG + Intergenic
917712532 1:177701155-177701177 CCATGGTTGCGCAGTGAATCTGG + Intergenic
918277696 1:182969613-182969635 CCAAGGTTACACAGATAATAAGG + Intergenic
918936603 1:190929683-190929705 CCAAGGCCACACAGAGCAGCAGG - Intergenic
919394054 1:197022826-197022848 CCAAGGCTGCACAGAGTAGCAGG - Intergenic
920471296 1:206232863-206232885 CCAAGGTCACACAGTTAATAGGG + Intronic
922178977 1:223218801-223218823 CCAAGATCACACAGTGAGCCTGG + Intergenic
923172678 1:231431339-231431361 CCGAGGCTGCACAGAGAAGCAGG + Intergenic
924391634 1:243566640-243566662 CCAAGGTCACACAGTGAATAAGG - Intronic
1068056248 10:52015407-52015429 CCAAGGCTGCACAGAGAAGCAGG + Intronic
1068163127 10:53293616-53293638 CCAAGGTTGCACAGAACAGCAGG - Intergenic
1068604457 10:58990111-58990133 CCAAGGCTGCACAGAGCAGCTGG - Intergenic
1069794199 10:71041853-71041875 CCAGGGTCACACAGGAAAGCAGG + Intergenic
1069911810 10:71764693-71764715 CCACGGTGAGAGAGTGAAGCAGG - Intronic
1070224200 10:74483327-74483349 TCAAGGTTGCACAGGGCAGCTGG + Intronic
1071506946 10:86238298-86238320 CCAAGGCTGCACAGAGCAGCAGG - Intronic
1072513801 10:96155960-96155982 CCAAGGTCACACAGCAGAGCTGG + Exonic
1072744846 10:97932866-97932888 CCAAGGTCACACAGTAAATAAGG + Intronic
1072750175 10:97973268-97973290 ACAAGGCTGAACAGTGAAGCCGG - Intronic
1073100930 10:101006313-101006335 CCAAGGTCATACAGTTAAGATGG - Intronic
1075176388 10:120165874-120165896 CCCAGGTTACTCAGTGACTCTGG - Intergenic
1075336139 10:121609957-121609979 CCAAGGTTACACAGTCGGGAGGG + Intergenic
1077489191 11:2852716-2852738 CCAAGGCTCCACAGTGGAGTTGG - Intergenic
1078959552 11:16248659-16248681 CCAAAGCTACACAGTGCAGGGGG + Intronic
1079498263 11:21071125-21071147 CCAAGATTACACAGCGAATGGGG - Intronic
1079769703 11:24444270-24444292 CCAAGGCTGCACAGAGTAGCAGG - Intergenic
1080297651 11:30749036-30749058 CCCAGGTTACACAGCCAAGCTGG + Intergenic
1081045649 11:38269976-38269998 CCAAGGCTGCACAGAGCAGCAGG + Intergenic
1081358642 11:42144851-42144873 CCAAGGCTGCACAGAGTAGCAGG + Intergenic
1081388786 11:42504036-42504058 CCAAGGTTGCACAGAGTAGCAGG + Intergenic
1084107563 11:66989757-66989779 CAAAGCTTCCACAGTGCAGCAGG - Intergenic
1084425131 11:69080288-69080310 TCAAGGTCACACTGTGAGGCAGG - Intronic
1084719441 11:70894822-70894844 CCAGGGGCACACAGTGAAGAAGG - Intronic
1085099474 11:73788303-73788325 CCAAGGTCACACAGTTAATCGGG - Intronic
1085454752 11:76659517-76659539 TCAAGGTCACACAGTGATCCGGG - Exonic
1085786600 11:79457080-79457102 CCAAGGTCACACAGCTAAGTTGG - Intergenic
1086914692 11:92516051-92516073 CCAAAGGTACAAAGAGAAGCTGG + Intronic
1086954823 11:92925283-92925305 CCAAGGTTGCACAGGGCAGCAGG - Intergenic
1087546369 11:99588769-99588791 TCAATATGACACAGTGAAGCAGG + Intronic
1088519748 11:110682878-110682900 CCAAGGTCACACAGATAATCAGG + Intronic
1089358943 11:117873848-117873870 CCAAGAAAACATAGTGAAGCAGG + Intronic
1089734721 11:120542185-120542207 ACAAGAATACACAGTGAAGAAGG + Intronic
1090836233 11:130456044-130456066 CCAAGGTTAGACAGAGAGGAAGG - Intronic
1091397470 12:162888-162910 TCAAGGTTACGGAGGGAAGCAGG + Intronic
1093591317 12:20905188-20905210 CCAAGGTTGCACAGGGCAGCAGG + Intronic
1094743347 12:33314740-33314762 CCAAGGATGCACAGAGCAGCAGG + Intergenic
1095171069 12:39037193-39037215 TCAAGCTTACACAGTGAGACAGG + Intergenic
1095782738 12:46078196-46078218 CCAAGGTTGCACAGGGCAGCAGG + Intergenic
1096050902 12:48606509-48606531 CCAAGGTTGCACAGGGCAGTGGG + Intergenic
1097085905 12:56468257-56468279 CCAAACTCACACAGTGAAGCCGG + Intronic
1098131402 12:67354317-67354339 GCAAGGTTTCACAGTGAGGGAGG + Intergenic
1098663345 12:73127907-73127929 GCAAAGTTCCAGAGTGAAGCTGG + Intergenic
1098836339 12:75428717-75428739 CCAAGGCTACACAGAGCAGCGGG - Intronic
1099558923 12:84148551-84148573 CTAAGGTTGCACAGGGCAGCAGG - Intergenic
1100980379 12:100158144-100158166 CTAGGGTTACACAGTGAGGGTGG - Intergenic
1101489172 12:105196114-105196136 CCAAGATCACATAGTGAATCAGG - Intronic
1101595072 12:106156977-106156999 CCAAGGCTATACAGTAGAGCAGG + Intergenic
1102017210 12:109655839-109655861 TCAAGGCTGCACAGTGATGCAGG - Intergenic
1102525478 12:113509647-113509669 CCAAGGTCACATAGTCAAGGTGG + Intergenic
1103145027 12:118588298-118588320 CCAAGGTCACACAGTCAACATGG - Intergenic
1104210517 12:126684124-126684146 CCAAGGCTGCACAGAGAAGCAGG + Intergenic
1104377918 12:128281403-128281425 CCATGTCTACACAGTGGAGCAGG - Intronic
1106035161 13:26037603-26037625 CCACGGGGACACAGTGAGGCTGG - Intergenic
1106383762 13:29264768-29264790 CCAAGGCTGCACAGGGCAGCAGG + Intronic
1106755951 13:32822694-32822716 CCAAGGTTACTTAGTAAAGGTGG + Intergenic
1107330677 13:39296423-39296445 CAGAGGTTACACAGAGCAGCAGG - Intergenic
1107646388 13:42498307-42498329 CCAAGGTTTCACATTAGAGCTGG + Intergenic
1108063043 13:46552471-46552493 CCAGGGGTACACTGTGAAGGAGG + Intergenic
1108770940 13:53699898-53699920 CCAAGGCTATACAGAGCAGCAGG - Intergenic
1109043059 13:57366621-57366643 TGAAGGATACACAGTAAAGCTGG - Intergenic
1109252198 13:60032610-60032632 TCAAGGTTGCACAGAGCAGCAGG + Intronic
1110782537 13:79482280-79482302 CAAAGTTTACACAGTTAAGCTGG - Intronic
1111217514 13:85163495-85163517 CCAAGGCTGCACAGGGCAGCAGG + Intergenic
1111912581 13:94328815-94328837 CGAAGGTCACATAGTGATGCAGG - Intronic
1112790319 13:102995559-102995581 CCAAGGTTGCACAGAGCAGCTGG + Intergenic
1113061010 13:106322839-106322861 CCAAGGCTGCACAGGGCAGCAGG - Intergenic
1114949383 14:27729511-27729533 CAAAGGTGACAAAGTGAAGCTGG + Intergenic
1115090425 14:29567686-29567708 CCAAGGTTGCACAGAGTAGGGGG + Intergenic
1116078220 14:40140378-40140400 CGTAGGTAACACAGTGAAGAGGG - Intergenic
1116526860 14:45916443-45916465 CCAAGGCTGCACAGAGCAGCAGG + Intergenic
1116998270 14:51346850-51346872 CCAAGGTTGCATAGAGCAGCAGG - Intergenic
1118377468 14:65189753-65189775 TCAGGGTCACACAGTGGAGCTGG + Intergenic
1119134771 14:72206982-72207004 GCAAGGATACACAGCAAAGCAGG - Intronic
1120194482 14:81467240-81467262 ACAGGGTGACACAGTGAATCGGG - Intergenic
1120377613 14:83729752-83729774 CCAAGGTTGCACAGAGCAGCAGG + Intergenic
1121231498 14:92362160-92362182 CCGGGGTTAGACAGAGAAGCTGG - Intronic
1123128100 14:105964231-105964253 CCAAGGCTCCAAAGAGAAGCTGG - Intergenic
1124319685 15:28703480-28703502 TCAGGGTTACACAGTGAGGGTGG - Intronic
1124482827 15:30091950-30091972 TCAGGGTTACACAGTGAGGGTGG + Intronic
1124489280 15:30144021-30144043 TCAGGGTTACACAGTGAGGGTGG + Intronic
1124520750 15:30405268-30405290 TCAGGGTTACACAGTGAGGGTGG - Intronic
1124537909 15:30560951-30560973 TCAGGGTTACACAGTGAGGGTGG + Intronic
1124544368 15:30613012-30613034 TCAGGGTTACACAGTGAGGGTGG + Intronic
1124564331 15:30800448-30800470 TCAGGGTTACACAGTGAGGGTGG + Intergenic
1124663145 15:31567739-31567761 CCAAGGCTACACAAGGTAGCGGG - Intronic
1124754248 15:32394303-32394325 TCAGGGTTACACAGTGAGGGTGG - Intronic
1124760744 15:32446635-32446657 TCAGGGTTACACAGTGAGGGTGG - Intronic
1124777890 15:32602428-32602450 TCAGGGTTACACAGTGAGGGTGG + Intronic
1125225397 15:37389824-37389846 CCAAGGCTGCACAGAGCAGCGGG + Intergenic
1125794471 15:42394264-42394286 CAAAGGTGAGAAAGTGAAGCTGG + Exonic
1126203815 15:46019758-46019780 CCAAGGCTGCACAGGGCAGCAGG - Intergenic
1127772774 15:62244262-62244284 CTAGGGTTACACAGTGAGGGTGG - Intergenic
1128319202 15:66681080-66681102 CCAAGGTCACACAGTGAGTAAGG - Intronic
1128557951 15:68644525-68644547 CCAAGGCTACACAGCTAAGTAGG - Intronic
1128984471 15:72209029-72209051 CCAGGATTACACAGTGTAGTAGG - Intronic
1129030174 15:72612146-72612168 TCAGGGTTACACAGTGAGGGTGG + Intergenic
1129219030 15:74120690-74120712 CCAAGGTCACACAGCAAAGCTGG - Intronic
1129684819 15:77679619-77679641 CCAAGGTCACACAGTTAATAAGG + Intronic
1130012587 15:80163195-80163217 CCAAGGTTGCAGAATGAGGCAGG + Intronic
1130276314 15:82477996-82478018 TCAAGGTTACACAGTGAGTGTGG - Intergenic
1130468676 15:84205389-84205411 TCAAGGTTACACAGTGAGTGTGG - Intergenic
1130485073 15:84394373-84394395 TCAAGGTTACACAGTGAGTGTGG + Intergenic
1130495599 15:84468190-84468212 TCAAGGTTACACAGTGAGTGTGG + Intergenic
1130590969 15:85209988-85210010 TCAAGGTTACACAGTGAGTGTGG - Intergenic
1131093619 15:89642090-89642112 ACAAGGTTCCACAGTGAACTTGG + Intronic
1131188394 15:90294244-90294266 TCAAGGTTACACAGTGAGTGTGG + Intronic
1131282430 15:91032550-91032572 CCAGGGTTACACAGTGAGGGTGG - Intergenic
1131732680 15:95298582-95298604 CCAAGGTCACAAAGTCAAGAAGG - Intergenic
1132133355 15:99306729-99306751 CCAAGGTCACTCAGCCAAGCTGG - Intronic
1132432564 15:101773201-101773223 TCAGGGTTACACAGTGAGGGTGG - Intergenic
1132520187 16:383738-383760 CCAAGGTCAACCAGTGTAGCCGG - Intronic
1134174190 16:11992686-11992708 CCAAGGGCACACAGTCAAGCAGG - Intronic
1134879213 16:17729667-17729689 CCAAGGTGGCCCAGGGAAGCAGG + Intergenic
1137539404 16:49351751-49351773 TCAAGGTTGCACAGTGAAGCTGG - Intergenic
1137606623 16:49791011-49791033 CCATGGTTACATAGTCAAGGGGG - Intronic
1137718214 16:50611750-50611772 CCAAGGTCACACAGTGAGTGTGG - Intronic
1138431397 16:56971438-56971460 CCAAGGCCACATAGTGCAGCAGG - Intronic
1141598827 16:85113327-85113349 CCAAGGTCACACAGCAGAGCGGG - Intergenic
1141897247 16:86965924-86965946 CCAAGATAACACACTGTAGCTGG - Intergenic
1141991603 16:87614058-87614080 CCCAGGTCTCACAGTGAAGCAGG + Intronic
1143102582 17:4512553-4512575 CCCAGGGTACAGAGGGAAGCAGG - Intronic
1144751833 17:17654029-17654051 CCAAGGCTGCACAGGGAAACGGG + Intergenic
1145245795 17:21268542-21268564 CCAAGGTCACACAGCAAAACTGG - Intergenic
1147135690 17:38432903-38432925 CCAAGGGCACACAGTGAACAAGG - Intronic
1147238558 17:39075511-39075533 CCAAGGTCACACAGCCAAGAAGG - Intronic
1149439118 17:56660645-56660667 CCAAGGCCACACAGGCAAGCAGG - Intergenic
1151561073 17:74869898-74869920 CCAAGCTTCCACCGTGGAGCAGG - Intronic
1151885644 17:76921811-76921833 CCAAGGTTACACAGCCAGGAAGG - Intronic
1152034867 17:77865878-77865900 CCGAGGTCAGACAGTGAAGGTGG - Intergenic
1152590099 17:81207399-81207421 CCAGGGTTCCTCAGTGGAGCTGG + Intronic
1153388940 18:4533053-4533075 CCAAGGCTGCACAGAGAAGTGGG + Intergenic
1155638657 18:27985854-27985876 CCAAGGTTACACAGTTAAAAGGG - Intronic
1155792993 18:29997628-29997650 CCAAGGTTGCACAGGGCAGCGGG - Intergenic
1156551827 18:38026896-38026918 CCACAGTGACACAGTGTAGCTGG - Intergenic
1156683353 18:39617195-39617217 CCAAGGTTTCACAGAGAAGCAGG + Intergenic
1157009278 18:43627304-43627326 CCAAGGTTAGCCAGTGCTGCTGG - Intergenic
1157278701 18:46331639-46331661 GCAAGGTTGCACAGAGAAACTGG + Intronic
1157301366 18:46482232-46482254 CCAAATTTATACATTGAAGCTGG + Intronic
1157784057 18:50466410-50466432 AAAAGGTTACATAGTGAAGGAGG - Intergenic
1159044937 18:63360856-63360878 CCTGGGTGACACAGTGAGGCCGG + Intronic
1159415343 18:68139776-68139798 CCAAGGGTACAAAGAGGAGCTGG - Intergenic
1162397397 19:10424894-10424916 CCAAGGTCACACAGCGAGGAAGG + Intronic
1162966523 19:14158803-14158825 CCAAGGTCACACAGTGAGAATGG - Intronic
1163015011 19:14449490-14449512 ACCAGGTTACACAGTCAACCAGG - Intronic
1163443635 19:17334206-17334228 CCAAGGTCACACAGTCAAGCTGG + Intronic
1163513560 19:17749641-17749663 CCCAGGTCACACAGTGACTCGGG - Intronic
1163584214 19:18155346-18155368 CCAAGGTCACCCAGTGATTCAGG + Intronic
1166385484 19:42378297-42378319 CCAGGGTCACACAGCAAAGCTGG + Intronic
1167468184 19:49661087-49661109 CCAAGGATGCTCAGTGAATCTGG + Intronic
1168079768 19:54001102-54001124 CCAAGGCCACACAGTGATTCAGG - Intronic
925094572 2:1185698-1185720 CCAAGATTGCACAGGGCAGCAGG + Intronic
926007661 2:9385072-9385094 TCAAGGTTACGCTGTGAAGTAGG + Intronic
926279398 2:11432873-11432895 CCAAGGTCCCACAGTGAAGAAGG - Intergenic
927351727 2:22124562-22124584 CCAAGGGTACACAGTAAGACTGG + Intergenic
927881032 2:26690231-26690253 CCAAGGTCACACAGTGAGTGAGG - Intergenic
929526377 2:42706995-42707017 CCTGGGTTACAGAGGGAAGCGGG - Intronic
931169355 2:59786479-59786501 CCACTGTTACACAGTAAAGGGGG + Intergenic
931314662 2:61117089-61117111 CCAAGGTTAACAAATGAAGCTGG + Intronic
931703364 2:64926557-64926579 CCAAGGCTGCACAGAGCAGCTGG - Intergenic
931769910 2:65488529-65488551 CCAAGGTCACACAGAAGAGCTGG - Intergenic
931994795 2:67829604-67829626 CCAAGGTCACACAGAGGAGGAGG + Intergenic
932818357 2:74879291-74879313 CCAAGGTCAGCCAGAGAAGCTGG - Intronic
932869974 2:75389028-75389050 CCAAGGGTACACAGTAAAGCCGG - Intergenic
934048760 2:88192634-88192656 CCAAGGTCACACAGCTAATCAGG + Intergenic
936441685 2:112559553-112559575 CCCAAGTTGCACAGTAAAGCTGG - Exonic
936730344 2:115374855-115374877 CCAAGGCTGCACAGAGCAGCTGG + Intronic
936821754 2:116530320-116530342 ACAAGGTTGCACAGGGCAGCAGG - Intergenic
938155917 2:128939868-128939890 CAAAGGTTACATAGTGCGGCAGG - Intergenic
939040906 2:137188585-137188607 CCAAGGAAACACAATTAAGCAGG - Intronic
939695216 2:145315052-145315074 TAAAGGTTACAGAGAGAAGCAGG - Intergenic
940826280 2:158416185-158416207 CCAAGGCTGCACAGGGCAGCAGG + Intronic
941159170 2:162016277-162016299 CCATGATTACACAATCAAGCCGG + Intronic
941416992 2:165233214-165233236 CCAAGGTTAGTGAGTGATGCAGG - Intergenic
945698699 2:213142652-213142674 CCAAGGTCACACAGCAAAGCAGG + Intronic
946127770 2:217579199-217579221 CTCAGGATACACAGTGGAGCTGG - Intronic
946283134 2:218681069-218681091 CCCAGATTATACAGTGAAGGAGG - Intronic
946903352 2:224393621-224393643 CCAAACTCACACAGTGAAGGAGG - Intronic
946937402 2:224736392-224736414 CCAAGGCTGCACAGAGCAGCTGG - Intergenic
947754639 2:232552626-232552648 CCAAGGTTACACAACAAACCTGG - Intronic
947802951 2:232943103-232943125 CCAAAGCTAAACAGAGAAGCAGG - Intronic
1170181607 20:13536777-13536799 CAAAGGTTAGACAGTGAAATAGG - Intronic
1170938521 20:20829906-20829928 CCAAGGCTACATAGAGCAGCAGG - Intergenic
1171397542 20:24847003-24847025 CCAGAGGTACACAGAGAAGCTGG - Intergenic
1172039527 20:32034341-32034363 CCAAGGTCACACAGTGAGCTGGG + Intergenic
1173067656 20:39728706-39728728 CCAAGGCTGCACAGGGCAGCAGG - Intergenic
1173246551 20:41341266-41341288 TCAAGGTCACACAGTCAGGCTGG - Intronic
1174386200 20:50189998-50190020 CCAAGGTCACACAGTGTGGCAGG + Intergenic
1174403914 20:50291670-50291692 CCGAGGTTACACAGCCAAGAAGG + Intergenic
1174452760 20:50629892-50629914 CCAAGGTCACACAGCAAAACTGG - Intronic
1177765285 21:25450384-25450406 CCAAGACTACACAGAGCAGCAGG + Intergenic
1177803203 21:25848532-25848554 CCAAGGCTGCACAGAGCAGCGGG - Intergenic
1179731940 21:43372943-43372965 ACAAGGTGAAACAGGGAAGCGGG - Intergenic
1181952142 22:26562195-26562217 CCAAGGTCACACAGCAAAGGAGG - Intronic
1182554815 22:31123378-31123400 CCAAGGTCACACAGCAAAGGTGG - Intronic
1183074077 22:35415717-35415739 CCAAGGTCACACATCAAAGCTGG - Intronic
1183128494 22:35809254-35809276 CCAAGGTCACACAGTTTAGTAGG + Intronic
1183458252 22:37934312-37934334 CCAGTGTCACACAGTGAAGGTGG - Intronic
1183622163 22:38980871-38980893 CCAAGGTCACACAGTAAGGAAGG + Intronic
1183627059 22:39010847-39010869 CCAAGGTCACACAGTAAGGAAGG + Intergenic
1183682938 22:39344698-39344720 CCAAGGTTACACAGTGAGTCAGG + Intergenic
1183741503 22:39670979-39671001 CCAAGGTTACAAGGTGAGGGTGG + Intronic
1184411099 22:44327019-44327041 TCAAGGTCACACAGTGAACTGGG - Intergenic
1184606274 22:45576490-45576512 CCCAGATCAGACAGTGAAGCAGG - Intronic
949206485 3:1445247-1445269 ACAAGGTTACAATGTGAAGGTGG - Intergenic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
950451253 3:13067066-13067088 CCAGGGTCACATAGTGAGGCAGG + Intronic
953924438 3:46975209-46975231 CCTAGGTTACAGAGTGAGACTGG - Intronic
954335723 3:49916159-49916181 CCAAGGTTACACAGCTAGGAGGG - Intronic
956432832 3:69204917-69204939 CCAAGGTCACACAGCGAAATAGG + Intronic
957698112 3:83670242-83670264 CAAAGATTACACAGTCATGCAGG + Intergenic
957868128 3:86050798-86050820 CCAAGGTTGCACAGAGTAGCTGG + Intronic
957953191 3:87150331-87150353 CCAAGGCTGCACAGAGCAGCTGG + Intergenic
959119218 3:102212524-102212546 CCAAGGCTGCACAGAGCAGCAGG + Intronic
959507372 3:107171182-107171204 CCAAAGCTACACAGAGCAGCTGG - Intergenic
959507889 3:107176071-107176093 CCAAGGCTACACACAGCAGCGGG - Intergenic
959862235 3:111229496-111229518 CCGAGGCTACACAGAGCAGCAGG - Intronic
960430019 3:117557836-117557858 CCAAGGTGACACAATAAGGCAGG + Intergenic
960708928 3:120507727-120507749 CCAAGAGTACACAGTAAGGCTGG + Intergenic
961390514 3:126549992-126550014 CAAAGGTTGCACAGTGGAGGTGG + Exonic
961505109 3:127365504-127365526 CCAAGGTGGCACATTGAAGGAGG - Intergenic
962196238 3:133366028-133366050 CCAAGGTCACACATTCAAGGTGG - Intronic
962837441 3:139202048-139202070 CCAAGGTCACACAGTGAGAGTGG + Intronic
963989782 3:151639844-151639866 CCAAGATTCCTCAGTGAAGGGGG - Intergenic
964741699 3:159973220-159973242 CCAAGGTTACACAATGAGTAAGG + Intergenic
964868521 3:161288289-161288311 CCCAGGTTTCACAGCAAAGCAGG - Intergenic
964974829 3:162606068-162606090 CCAAGGCTGCACAGAGCAGCGGG - Intergenic
965510633 3:169565129-169565151 CCAAGGTTACACAGTGGGGAGGG + Intronic
965767421 3:172145580-172145602 ACAAGGTACCACAGTGCAGCAGG - Intronic
966237305 3:177716355-177716377 CCATGGTTCCACATTGAAACTGG + Intergenic
966744782 3:183265202-183265224 CCAAGGTTACACAATAAATCTGG + Intronic
967423380 3:189298470-189298492 CCAAGGTCACACAGTAATGCTGG + Intronic
967567375 3:190988309-190988331 CCAAGGCTGCATAGAGAAGCAGG - Intergenic
967748234 3:193083736-193083758 CCAAGGATGCACAGGGCAGCAGG - Intergenic
967859430 3:194140594-194140616 CCAAGGTGACACAGTGAATTTGG - Intergenic
968014681 3:195318988-195319010 CCAAGGCTGCACAGAGCAGCAGG - Intronic
968681661 4:1925143-1925165 CCTAGGTTACAGATGGAAGCAGG - Intronic
970790736 4:19854754-19854776 CCAAGGTTTCACAGGGAAGTGGG + Intergenic
970865177 4:20750222-20750244 CCAAAGTCACACAGTGAAGAAGG + Intronic
971767587 4:30853207-30853229 ACAAGGTCACACAGTTAAGAGGG - Intronic
972778092 4:42261738-42261760 CCCAGCTAACACAGTGAGGCGGG - Intergenic
973893372 4:55389699-55389721 ACAAGGTCACACAGGGAGGCAGG + Intergenic
974625913 4:64429067-64429089 CCAAGGTTATACAGGGGAGAGGG - Intergenic
975626964 4:76360021-76360043 CCAAGGCTGCACAGTGCAGCAGG - Intronic
976216233 4:82718145-82718167 CCAAGGTTTCACAGAAGAGCTGG + Intronic
976842306 4:89445735-89445757 CCAAGGCTACACAGAACAGCAGG + Intergenic
976949820 4:90814217-90814239 CCAAGGCTACACAGAGCAGCAGG + Intronic
977045990 4:92070153-92070175 CCAAGGCTGCACAGGGCAGCAGG - Intergenic
977270933 4:94916910-94916932 CCAAGGCTGCACAGGGCAGCAGG - Intronic
977983933 4:103360131-103360153 CCGAGGTTGCACAGGGGAGCAGG - Intergenic
978322658 4:107515481-107515503 CCAAGGCTACACAGGGTAGTGGG - Intergenic
978983646 4:114982857-114982879 CCTAGGCTGCACAGAGAAGCTGG - Intronic
979420769 4:120502592-120502614 CCTAGGTTGCACAGAGCAGCAGG + Intergenic
983393893 4:167168872-167168894 CCTAGGCTACACATAGAAGCAGG - Intronic
984346940 4:178540596-178540618 CCCAGGTGGCACAGTGAAGCCGG - Intergenic
985076751 4:186223948-186223970 CCAAGGCTGCACAGAGCAGCAGG - Intronic
985368622 4:189260951-189260973 CCAAGGTTGCACAGGGCAGCAGG + Intergenic
986538301 5:8815706-8815728 CCAAGGCTGCACAGAGCAGCAGG - Intergenic
986582002 5:9275395-9275417 CCAAAGGTACAAAGAGAAGCTGG + Intronic
986869262 5:12028121-12028143 CCAAGGCTGCACAGAGCAGCAGG + Intergenic
987636242 5:20545638-20545660 CCAAGGCTGCACAGAGCAGCAGG + Intronic
987908164 5:24105741-24105763 CAAAGGTTGCACAGGGCAGCAGG + Intronic
987956945 5:24752367-24752389 CCAGAGTTACAAAGAGAAGCTGG - Intergenic
988040971 5:25888428-25888450 CCAAGGCTGCACAGAGCAGCAGG + Intergenic
988256202 5:28823179-28823201 CCTAGGTTGCACAGGGCAGCAGG - Intergenic
989182092 5:38588285-38588307 TCAGGGCTACACAGTCAAGCAGG + Intronic
990226077 5:53655952-53655974 GCAAGGTTTCAAAATGAAGCTGG - Intronic
990249019 5:53893735-53893757 TGAAGGTTACCCAGTTAAGCTGG - Intronic
990310120 5:54529748-54529770 CCAAGGTTACACAGTGAAGCTGG - Intronic
990350339 5:54909457-54909479 CCAGGGTCACACAGCCAAGCTGG + Intergenic
991186544 5:63815390-63815412 CCAAGGATACACAGAGCAGCAGG - Intergenic
992046293 5:72893567-72893589 CCAATGTGACACAGAGAAACAGG - Intronic
993084624 5:83348541-83348563 CCAAGACTGCACAGTGTAGCAGG + Intronic
993190098 5:84670349-84670371 CCAAGGCTACACAGAGCATCAGG - Intergenic
993752895 5:91692226-91692248 CCAAGGTTGCACACAGCAGCAGG + Intergenic
994176323 5:96715483-96715505 CTAAGATTACACAGTTAAGAAGG - Intronic
994580301 5:101632901-101632923 CCAAGGTTGCACAGAGTAGTCGG + Intergenic
995009766 5:107244079-107244101 CCAAAGATACACACTGCAGCAGG + Intergenic
996071458 5:119136608-119136630 CCAAGGCTGCACAGAGCAGCTGG - Intronic
996126105 5:119727430-119727452 CCAAGGCTGCACAGAGCAGCAGG - Intergenic
997046927 5:130330122-130330144 CCAAGGCTGCACAGAGCAGCAGG - Intergenic
997789303 5:136742990-136743012 CCAAGGATGCACAGAGCAGCAGG - Intergenic
999202119 5:149823934-149823956 TCAAGGTCACACAGTGAGTCAGG - Intronic
999256232 5:150211328-150211350 TCAAGGTTACCCAGCCAAGCCGG + Intronic
999383710 5:151139730-151139752 CCAAGGTCTCACAATGAACCTGG + Intronic
1000250932 5:159494670-159494692 ACAAGTTTACACAGTGGAACTGG + Intergenic
1000354102 5:160376904-160376926 CCAAGGTTACACATTGAATGAGG + Intergenic
1001774275 5:174316884-174316906 CCAAGGCTACACAGTGAGTGGGG - Intergenic
1002082394 5:176745157-176745179 CCAAGGTCATACAGTGAAGGCGG - Intergenic
1002327087 5:178416720-178416742 CCAAGGTCACACAGTTAAGTAGG + Intronic
1002612929 5:180433223-180433245 CCAAAGACACAGAGTGAAGCAGG - Intergenic
1003838229 6:10093700-10093722 CCAAGGCTGCACAGAGCAGCAGG + Intronic
1004165910 6:13256241-13256263 CCAAGGCTGCACAGGGCAGCGGG + Intronic
1004430199 6:15536377-15536399 CCAAGGCTGCACAGAGCAGCTGG - Intronic
1004996477 6:21198696-21198718 CAAAGCTCTCACAGTGAAGCTGG - Intronic
1005024105 6:21446461-21446483 CCAAAGTTTCAAAGAGAAGCTGG + Intergenic
1005116578 6:22345096-22345118 CCAAGGTCACACAGTTAGCCTGG - Intergenic
1007021465 6:38526147-38526169 CCAAGGCTGCACAGAGCAGCAGG - Intronic
1007324581 6:41050183-41050205 CCAAGATCACACAGTGAATCGGG + Intronic
1007640102 6:43331279-43331301 CAAAGGAGACTCAGTGAAGCGGG - Intronic
1007967803 6:46018082-46018104 CCAAGGTTACAGAGGGAGACTGG + Intronic
1008199127 6:48564643-48564665 CCAAGGCTACACAGGGCAGCAGG - Intergenic
1008670804 6:53766702-53766724 CCAAGTTCATACAGTGGAGCTGG + Intergenic
1009345580 6:62610040-62610062 CCAAGATTGCACAGAGCAGCTGG + Intergenic
1009461704 6:63921232-63921254 CCACAGTCACACAGTGCAGCGGG - Intronic
1009680151 6:66881281-66881303 CCAAGGCTGCACAGTGTAGTAGG + Intergenic
1010360423 6:74987020-74987042 CCAAGGCTTCACAGGGCAGCGGG - Intergenic
1010936923 6:81873162-81873184 CCAAAGTTACAAAGAGGAGCTGG + Intergenic
1012153845 6:95791352-95791374 CCAAGGTGAAACAGTGATTCAGG - Intergenic
1012485866 6:99722269-99722291 CCAAGGATACACACAGGAGCAGG - Intergenic
1012805824 6:103891474-103891496 CCAAGTGTACAGAGTGAAACAGG + Intergenic
1013690992 6:112643478-112643500 TCAAGGTTATTCAGTGAAGAAGG - Intergenic
1014228268 6:118873144-118873166 CCTAGGTAACACAGTGAGACAGG + Intronic
1015019305 6:128452950-128452972 TCAATGTGACACAGTGAAGTTGG - Intronic
1015321060 6:131875459-131875481 CCCACCTTACACAGTGATGCAGG - Intronic
1015465306 6:133542602-133542624 CCTGGCTGACACAGTGAAGCAGG - Intergenic
1016056374 6:139581961-139581983 CCTAGGTGACAGAGTGAAGATGG - Intergenic
1016126282 6:140408284-140408306 CCAAGGCTACACAGAGCAGCAGG - Intergenic
1016264359 6:142213789-142213811 CCAAGGCTACACAGAGCAGCTGG + Intronic
1016515832 6:144892485-144892507 CCAAGGTCAAACAGTGAAGCTGG - Intergenic
1016738395 6:147505601-147505623 CCAAGGTCACACAGTCAATCAGG - Intergenic
1017275782 6:152566247-152566269 GCAAGGTAACACAGAGATGCTGG + Intronic
1017392770 6:153959007-153959029 CCAAGGCTTCACAGGGCAGCAGG + Intergenic
1017711599 6:157173919-157173941 CACAAGTTACAGAGTGAAGCAGG - Intronic
1017717674 6:157223707-157223729 CCAAGGGAACACAGAGAAGGTGG + Intergenic
1018162636 6:161061541-161061563 CCAAAGTTACACAGTGAGGATGG - Intronic
1018928161 6:168221687-168221709 CCAAATCTACAGAGTGAAGCAGG - Intergenic
1020074192 7:5246979-5247001 CTTAGCTAACACAGTGAAGCTGG - Intergenic
1020094027 7:5357782-5357804 ACAGAGTTACACATTGAAGCTGG - Intronic
1021118287 7:16768396-16768418 CCAAGGTTAGACAGTAAGGAAGG - Intronic
1021519652 7:21526670-21526692 CCAAGTTTGCACAGGGCAGCAGG - Intergenic
1021617670 7:22519787-22519809 CCAAGGCTGCACAGAGCAGCAGG - Intronic
1022861426 7:34370961-34370983 CCAAGGATAGACAGTGATGGAGG + Intergenic
1022927263 7:35069277-35069299 CCAAGGCTGCACAGAGCAGCAGG - Intergenic
1023284116 7:38601720-38601742 ACAAAGTTACACAGTGGAGCTGG - Intronic
1024778810 7:52822023-52822045 CCAAGGCTGCAAAGAGAAGCAGG + Intergenic
1025088724 7:56044777-56044799 CCTAGGTGACACAGTGAGACTGG + Intronic
1025204900 7:56986831-56986853 CTTAGCTAACACAGTGAAGCTGG + Intergenic
1025667038 7:63590104-63590126 CTTAGCTAACACAGTGAAGCTGG - Intergenic
1027419890 7:78008692-78008714 CCAAGGGTACACAGTAAGACTGG + Intergenic
1027560266 7:79719834-79719856 CCAAGGCTACACAGAGTAGCAGG + Intergenic
1028375005 7:90136317-90136339 CCAAGGCTGCACAGAGCAGCAGG + Intergenic
1029619386 7:101680382-101680404 CCAAGTTCACACAGTGACCCCGG - Intergenic
1029663358 7:101978458-101978480 CCAAGGTGACAGCGTGTAGCTGG - Intronic
1030072812 7:105712167-105712189 CCAAGGCTGCACAGGGCAGCTGG + Intronic
1030081380 7:105781797-105781819 CCAAGGTCACACAGGGAATAAGG + Intronic
1030726377 7:112930846-112930868 CCAAGGTTACACAACAAACCTGG + Intronic
1032544132 7:132727838-132727860 CCTAAGTTACACAGAGAACCTGG + Exonic
1032864288 7:135910456-135910478 CCAAAGTCCCACAGTAAAGCTGG + Intergenic
1034876182 7:154726527-154726549 CCAAGGCTGCACAGAGAAGTGGG + Intronic
1035433803 7:158842461-158842483 CCAAGGTCACTCAGAGAAGCAGG - Intergenic
1035547885 8:497798-497820 CCAGAGGTGCACAGTGAAGCAGG - Intronic
1037574840 8:20192078-20192100 CCAAGGTTACACTGTGCATAAGG + Intergenic
1038310317 8:26441285-26441307 ACAAGGGTACACAGTGGAGTGGG + Intronic
1038894656 8:31768929-31768951 CCATGGTTAGACACTGAACCTGG - Intronic
1039406003 8:37313048-37313070 CCAAGGTCACTCAGTGAGGTGGG - Intergenic
1039629421 8:39092870-39092892 CCAAGAATACACAATGAAGAAGG - Intronic
1040863435 8:52024051-52024073 CCAAGGATGCACAGAGAAGTTGG - Intergenic
1040880901 8:52203283-52203305 CCAAGGTCACACAGCTAATCAGG + Intronic
1041324145 8:56647443-56647465 CCAAGGTCAGAAAGTGAAGGAGG - Intergenic
1042214002 8:66410838-66410860 CCATGGTGAAACAGTAAAGCAGG + Intergenic
1042950227 8:74193633-74193655 CCGAGGTGGCACAATGAAGCTGG - Intergenic
1042982137 8:74541222-74541244 CCAAGGCTGCACAGAGCAGCAGG + Intergenic
1043584487 8:81752321-81752343 CCAAGGTGCCACAGTCAAGAGGG + Intronic
1043619488 8:82171167-82171189 CCAAAGATACAAAGAGAAGCTGG - Intergenic
1043959974 8:86406158-86406180 CCAAGGTTACAGAGTTAACATGG - Intronic
1044917622 8:97132319-97132341 CCCAGGTGACACAATGGAGCTGG - Intronic
1045908966 8:107382958-107382980 CCAAGCTAATACATTGAAGCAGG + Intronic
1048583988 8:135755785-135755807 CTCAGGTTACCCAGAGAAGCAGG - Intergenic
1048640121 8:136347301-136347323 GCAAGGTCACGCAGGGAAGCTGG + Intergenic
1049294021 8:141820402-141820424 CCAAGGTCACTCAGAGAATCAGG - Intergenic
1049358790 8:142202019-142202041 CCAAGGTCACATACTGAAGGCGG + Intergenic
1051815649 9:21102554-21102576 CCAAGGTTACAACATGGAGCAGG - Intergenic
1052717267 9:32132070-32132092 CCAAAGTTACAAAGAGGAGCTGG + Intergenic
1053693842 9:40616853-40616875 AGAAGGATACACAGTGGAGCAGG + Intergenic
1054270996 9:63023283-63023305 AGAAGGATACACAGTGGAGCAGG - Intergenic
1054305087 9:63416077-63416099 AGAAGGATACACAGTGGAGCAGG + Intergenic
1054403832 9:64740057-64740079 AGAAGGATACACAGTGGAGCAGG + Intergenic
1054437452 9:65225567-65225589 AGAAGGATACACAGTGGAGCAGG + Intergenic
1054492951 9:65796414-65796436 AGAAGGATACACAGTGGAGCAGG - Intergenic
1054868341 9:70025727-70025749 CCGAGGTTGCACAGAGCAGCAGG + Intergenic
1057744458 9:97740232-97740254 CCAAGGTCACACAGTGCAACAGG + Intergenic
1058062382 9:100511375-100511397 CCAAGGTCACACAGTAAATAAGG - Intronic
1058288598 9:103210165-103210187 CCTAGGCTACACAGAGCAGCAGG + Intergenic
1058309708 9:103485355-103485377 CCAAGGCTCCACAGAGTAGCAGG - Intergenic
1059060119 9:111027105-111027127 CCAAAGTTACAAAGAGGAGCTGG - Intronic
1059158513 9:112011786-112011808 CCAAGCTTATAGAGTGAAGTTGG + Intergenic
1059187033 9:112283804-112283826 CCAAGGCTGCACAGAGCAGCAGG - Intronic
1059262383 9:112990691-112990713 CCACGGGTACAAAGAGAAGCTGG - Intergenic
1060152144 9:121295628-121295650 CCAAGGTTACAGAGGAAAGGAGG + Intronic
1061062726 9:128258636-128258658 CCAGGGTTACACAGTGAGGGTGG - Intronic
1061389204 9:130307809-130307831 CCAGGGTCACCCAGGGAAGCCGG - Intronic
1186053286 X:5623504-5623526 CCAAGGCTGCACAGAGCAGCAGG - Intergenic
1186636386 X:11409492-11409514 CCAAGGTGACACTGTGAAGGTGG + Intronic
1186995206 X:15114244-15114266 CCAAGGTCACACAGCTAAGTAGG + Intergenic
1188351509 X:29136656-29136678 TCAAGATCACACAGTGAGGCTGG - Intronic
1188389882 X:29606889-29606911 AGAAAGTTAAACAGTGAAGCAGG + Intronic
1189139630 X:38588577-38588599 CCAAGATTACATAGTGGAACTGG - Intronic
1190045621 X:47109731-47109753 CCAAGCTTCCACAGTGTAGAAGG + Intergenic
1190387590 X:49898026-49898048 CCAAGGCTGCACAGAGCAGCAGG - Intergenic
1191713443 X:64177049-64177071 CCAAGGTCACACAGATGAGCAGG + Intergenic
1192219789 X:69189994-69190016 CCAAGGTTCTACACTGAAGCAGG - Intergenic
1192246307 X:69374657-69374679 CCAAGGTTACACAGTAGAGCTGG - Intergenic
1192841671 X:74863674-74863696 CCAAAGGTACAAAGTGGAGCTGG + Intronic
1193492015 X:82162096-82162118 CCGAGGTTGCACAGGGCAGCAGG - Intergenic
1193758343 X:85436233-85436255 CCAAGGTTGCACAGGGCAGCAGG - Intergenic
1193930058 X:87542439-87542461 CCAAGGCTGCACAGTGCAGCAGG - Intronic
1193948228 X:87764438-87764460 CCAAGGCTGCACAGAGCAGCTGG + Intergenic
1194374019 X:93110360-93110382 CCAAGACTACACAGGGCAGCAGG + Intergenic
1194398947 X:93419739-93419761 CCAAGGGTACACAGTAAGACTGG - Intergenic
1194409863 X:93544128-93544150 CCGAGGTTACACAGGGCAGCCGG + Intergenic
1194450677 X:94041589-94041611 CCAAGGCTGCACAGAGCAGCTGG - Intergenic
1194558909 X:95396581-95396603 TCAAGGCTACACAGGGCAGCAGG - Intergenic
1194900367 X:99502361-99502383 CCAAGGTTACACAGGTATGGAGG + Intergenic
1194903376 X:99542926-99542948 CCAAGGCTGCACAGAGCAGCAGG - Intergenic
1195744130 X:108097183-108097205 CCAAGGTCACACAGTTTAGTTGG + Intronic
1196366793 X:114932694-114932716 CCAAGGCTGCACAGGGCAGCAGG + Intergenic
1196383861 X:115126046-115126068 CCAAAGTTACACAGTGAATTTGG + Intronic
1196512809 X:116532299-116532321 CCAAGGCTCCACAGAGAAGGAGG + Intergenic
1197440009 X:126476203-126476225 CCAAGGCTGCACAGAGAAGCAGG + Intergenic
1197725273 X:129772149-129772171 CCAAGGTCACACAGTCCAGTGGG + Intergenic
1197961675 X:132013205-132013227 CCAAGGTTACACAGCTAATAAGG + Intergenic
1199117425 X:144008838-144008860 CCAAGGCTGCACAGAGCAGCAGG + Intergenic
1199924361 X:152447125-152447147 CCAAGATGACACAGTCAAGTAGG - Intronic
1200682048 Y:6224431-6224453 CCAAGACTACACAGGGCAGCAGG + Intergenic