ID: 990310540

View in Genome Browser
Species Human (GRCh38)
Location 5:54533882-54533904
Sequence GTGGAGACCAACAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 416}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990310540 Original CRISPR GTGGAGACCAACAGGGAGGA AGG Intronic
900243687 1:1628310-1628332 GTGGACGCCAAGAAGGAGGACGG + Exonic
900365259 1:2309638-2309660 GCTCAGACCCACAGGGAGGAGGG - Exonic
900365297 1:2309715-2309737 GTTCGGACCCACAGGGAGGAGGG - Exonic
900365338 1:2309792-2309814 GTTCGGACCCACAGGGAGGAGGG - Exonic
900365361 1:2309833-2309855 GTTCGGACCCACAGGGAGGAGGG - Exonic
900552826 1:3265082-3265104 GGGGAGACCAGCAGGGAGGCGGG + Intronic
901646232 1:10718210-10718232 GTGGACGGCAACAGGGCGGAAGG - Intronic
901943626 1:12683416-12683438 GTGGAGAGGAAAAGGCAGGAGGG + Intergenic
902388153 1:16087952-16087974 GTGGGGAGGCACAGGGAGGAGGG - Intergenic
903753678 1:25646188-25646210 GCGGGGACCAGCACGGAGGAAGG - Intronic
903886793 1:26545645-26545667 TTGTAGGCCCACAGGGAGGATGG + Intronic
904478994 1:30782547-30782569 GGGGAGACGGACAGGGAGGAAGG + Intergenic
904909298 1:33922094-33922116 GTGGGGAAGAGCAGGGAGGAAGG - Intronic
905004449 1:34698599-34698621 GGGGAGCCCCACAAGGAGGAAGG + Intergenic
906485643 1:46232725-46232747 CTAAAGACCAACATGGAGGAGGG - Intergenic
906520146 1:46461967-46461989 GAGGAGACCAGGAGGGAGGCAGG - Intergenic
906609677 1:47192703-47192725 GTGAAGACCTCCAGGGAGGAGGG - Intergenic
906699691 1:47848944-47848966 ATGGGGACCCACAGGGATGAAGG - Intronic
907649071 1:56276148-56276170 CTGGAGACGAACAGAGAGGAGGG - Intergenic
908097483 1:60754244-60754266 GTGAAGACCTACAGGCATGAAGG - Intergenic
908683414 1:66687818-66687840 GTGGAGACAGAGAGGGAGCAGGG + Intronic
909273302 1:73652123-73652145 GTCCAGAGCAACTGGGAGGATGG - Intergenic
910567109 1:88656644-88656666 CTGTGGACCAACAAGGAGGAAGG + Intergenic
910721430 1:90290570-90290592 GGGGAGAGCAGCAGGGAGGAGGG + Intergenic
912559198 1:110538125-110538147 GTGCAGACCGACTGAGAGGACGG + Intergenic
914347799 1:146814939-146814961 GTTGGGAGCAACAGGGTGGAGGG - Intergenic
914968171 1:152279868-152279890 ATGGAGACCAAAAGTGAGTAGGG + Intergenic
915128931 1:153683890-153683912 GTGGGGACCCAGAGGGAAGAGGG + Intronic
915211480 1:154312898-154312920 CAGGAGTCCAACAGGGAGAAAGG - Intergenic
915212613 1:154321875-154321897 CAGGAGACCAACAGGGAGAAAGG - Intronic
915345873 1:155196565-155196587 GTGGAGATGAACAGGAAGGGAGG - Intronic
915492926 1:156261453-156261475 GTGGAGAACAGCAGTGAGCAAGG + Intronic
917621131 1:176797163-176797185 GTTGTTACCAATAGGGAGGAAGG + Intronic
917737624 1:177934967-177934989 GTGGGGAGCAGTAGGGAGGAGGG - Intronic
917808920 1:178638600-178638622 CTGGAGACCTAAAGGAAGGAAGG - Intergenic
919516741 1:198534289-198534311 GAGCAGACACACAGGGAGGAAGG + Intronic
919625802 1:199909098-199909120 CTGGAGACCACCAGTGAGGTTGG + Intergenic
919860627 1:201737533-201737555 GGTGAGACACACAGGGAGGAGGG + Intronic
920170599 1:204070087-204070109 CTGGAGACCAGGATGGAGGAGGG + Intergenic
921560505 1:216652872-216652894 GGGGAGCCGAACAGGGTGGAAGG - Intronic
921804807 1:219442165-219442187 GGGGAGAAAAACAGGGAGGAAGG - Intergenic
921946779 1:220891427-220891449 GTGGAAACCAACTGGTAGGGAGG + Intergenic
923685514 1:236150774-236150796 GTAGTGACCAGCAGGGAGGCAGG + Intronic
924861271 1:247925079-247925101 CTGGACACCATGAGGGAGGAAGG + Intergenic
1065200008 10:23303875-23303897 GTGGAGCCCAAGACTGAGGAGGG + Intronic
1065552373 10:26881810-26881832 GTGAAGACCCACAGGGTGGAGGG + Intergenic
1066469275 10:35682240-35682262 GAGGATTCCACCAGGGAGGAAGG + Intergenic
1066580871 10:36880609-36880631 GTGAAGACCCACAGGGTGGAGGG + Intergenic
1066688323 10:38002222-38002244 GTGGACTCCAAAAGGGGGGAGGG + Intergenic
1067005536 10:42657350-42657372 GTGGACTCCAAAAGGGGGGAGGG - Intergenic
1068378318 10:56213469-56213491 GGAGAGACCAGCAGGCAGGAGGG + Intergenic
1069307465 10:66988844-66988866 GTGGAGAGAAACAGGGAGGAGGG - Intronic
1069341698 10:67417284-67417306 GTGGACTCCAAGAGGGTGGAAGG + Intronic
1069416811 10:68207860-68207882 GTGGAAACTCACAGGGAGGGTGG - Intronic
1070430813 10:76335891-76335913 CTGAATTCCAACAGGGAGGAGGG + Intronic
1071562520 10:86655237-86655259 ATGGAGCCCTCCAGGGAGGAGGG + Intronic
1071967655 10:90868618-90868640 GGGGAGATGAACAGGGAAGAGGG - Intergenic
1073100806 10:101005698-101005720 GAGGAGACCAAGTGGGAGGTGGG + Exonic
1073328875 10:102658127-102658149 GTTGAGGTCAGCAGGGAGGAGGG + Exonic
1073909189 10:108321108-108321130 GTTAAGACACACAGGGAGGATGG - Intergenic
1075634495 10:124021037-124021059 CAGGTGACCAGCAGGGAGGAAGG + Intronic
1076057983 10:127391059-127391081 GTAGATACCAACAGGCAGGCAGG - Intronic
1076426444 10:130370646-130370668 GAAGAGGCCAACAGGGAAGAAGG - Intergenic
1076939312 10:133590935-133590957 GTGGAGACAAACGGGGTGGCAGG - Intergenic
1077480373 11:2811784-2811806 GTGGAGACCACCAAAGAGGAGGG + Intronic
1077564942 11:3291716-3291738 AAGGAGACTAACAGTGAGGATGG - Intergenic
1077570828 11:3337533-3337555 AAGGAGACTAACAGTGAGGATGG - Intergenic
1077797574 11:5508266-5508288 GTGGAGACCAAGATGGTGCAGGG - Exonic
1078143014 11:8705246-8705268 GTGGAGAGAAATAGGGAAGAGGG - Intronic
1079137906 11:17786689-17786711 ATGGAGGCCAAAAGGGGGGAAGG - Intergenic
1080536837 11:33230244-33230266 GTGGAGACTCAGAGGGATGAAGG + Intergenic
1080738101 11:35037112-35037134 GAGGAGCCCAACAAAGAGGATGG - Intergenic
1080891973 11:36416964-36416986 CTGGAGAGCAGCACGGAGGAGGG - Intronic
1081134778 11:39426710-39426732 GTGGAGAGGAAAGGGGAGGATGG + Intergenic
1081244206 11:40744414-40744436 GTGAAGACCAACAGATAAGATGG + Intronic
1081660025 11:44882344-44882366 GTGGAGACCCGCTGGGAGCAGGG - Intronic
1081716798 11:45256232-45256254 GTGGAGAAGAGGAGGGAGGAAGG - Intronic
1083025715 11:59549157-59549179 GTGGGGACGAGCAGGGAGGTTGG + Intergenic
1083400986 11:62423501-62423523 GTGCAGCCCAGCGGGGAGGATGG - Intergenic
1083705189 11:64509264-64509286 GTGTAGGCCATCAGGGAGGTCGG - Intergenic
1083977535 11:66135629-66135651 GAGGAGGCCAGCAGGGATGAGGG - Intronic
1084431005 11:69111216-69111238 GTGAGGACCACCAGGAAGGAAGG + Intergenic
1084758910 11:71256067-71256089 GTGGGGAGCAGCAGGCAGGAGGG + Intergenic
1085054343 11:73395139-73395161 GTGAAGACCATCACGGAGGCTGG + Exonic
1085235098 11:75008483-75008505 GTGGATAGGAATAGGGAGGATGG + Exonic
1085261097 11:75205154-75205176 GTAGACTCCCACAGGGAGGACGG + Exonic
1085537748 11:77234500-77234522 GGGGAGTCCAAAATGGAGGAGGG - Intronic
1086190254 11:84070662-84070684 GTTGAGAACAACAAGGAGCATGG + Intronic
1087455631 11:98382842-98382864 CTGGATACCAGCAGGGTGGAAGG + Intergenic
1088726986 11:112647797-112647819 GTGGAGACCGATTGGGTGGATGG + Intergenic
1092145795 12:6213837-6213859 GTGGGGGCCAAGAGGGAGGGAGG - Intronic
1092234198 12:6795905-6795927 GTGGAGAGCCACAGACAGGATGG + Intronic
1092547651 12:9466082-9466104 CAGGAGACCAACAGAGAAGAAGG - Intergenic
1092754661 12:11752347-11752369 GTGGGGAGCAAAAGGGAGGCGGG - Intronic
1095949505 12:47773993-47774015 GCTGAGACCCACAGGGAGGACGG + Intronic
1096486473 12:51985335-51985357 GTGGGGACCAAACGGTAGGAGGG + Exonic
1096558596 12:52419494-52419516 GAGGAGAGGAACAGGGAGAAAGG + Intergenic
1096718729 12:53505968-53505990 CTGGAGAGCAAGAGAGAGGAGGG - Intronic
1098659525 12:73075041-73075063 GTGGAGTCCAAGATGTAGGATGG + Intergenic
1101649172 12:106659249-106659271 TTGGGGACCCACAGTGAGGAAGG + Intronic
1101901192 12:108792395-108792417 GAGGAGACGGAAAGGGAGGAGGG - Exonic
1102176732 12:110881275-110881297 GAGCAGGCCAAAAGGGAGGAAGG + Exonic
1102983970 12:117264106-117264128 GTGGTGACCACCATGGGGGAAGG + Intronic
1103135065 12:118499800-118499822 GTGGACACAGACAGGGAGGCAGG - Intergenic
1103845935 12:123902149-123902171 GTGCAGACACACAGGGAAGAGGG - Intronic
1103952364 12:124558103-124558125 GCTGAGACCATCAGGGAGCATGG - Intronic
1103992111 12:124806213-124806235 GTGGGGAGCAAGAGAGAGGAAGG + Intronic
1105696827 13:22897587-22897609 GAGGAGCCCAGCAAGGAGGAAGG - Intergenic
1105892723 13:24693355-24693377 ATGGAGAGGAAAAGGGAGGAAGG - Intronic
1107869203 13:44731614-44731636 GGGGAGACCAACAGTCATGACGG - Intergenic
1108430466 13:50348117-50348139 GGGGTGACCCACAGCGAGGAAGG + Intronic
1108728363 13:53205312-53205334 ATGGAGAGTGACAGGGAGGAGGG - Intergenic
1111986659 13:95072749-95072771 GTGAAGAACAGAAGGGAGGAAGG - Intronic
1112203973 13:97305898-97305920 GAGGAGCGGAACAGGGAGGAAGG + Intronic
1112814019 13:103251315-103251337 GTGGAGTCCAACAGCCACGAGGG - Intergenic
1112844043 13:103616064-103616086 GTGGAGATCAAGAGTGATGAGGG + Intergenic
1113056871 13:106277874-106277896 GTACAAACCAGCAGGGAGGAAGG - Intergenic
1113954357 13:114089280-114089302 GGGGAGACGAGCGGGGAGGAGGG + Intronic
1114260106 14:21030433-21030455 GGAGAGAGCAACAGGGAAGAGGG + Intronic
1114479241 14:23021643-23021665 GGGCAGAAAAACAGGGAGGAAGG - Intronic
1114657766 14:24326226-24326248 GAGCAGACCCCCAGGGAGGATGG + Intronic
1115619423 14:35126518-35126540 GAGGAGAACCACAGGGAAGAAGG + Intronic
1116852365 14:49921130-49921152 CAGGAGACCAACAGTGAGCATGG - Intergenic
1116950692 14:50875939-50875961 CTGGAGACTAACAGGCAGGGTGG + Intronic
1117617282 14:57546432-57546454 GGGGGGACCAGAAGGGAGGAGGG + Intergenic
1119776474 14:77252229-77252251 CTGGAGGCCAAGAGAGAGGATGG + Intronic
1120380063 14:83765863-83765885 GTGGACACCAACAGAGAGGTTGG - Intergenic
1121026039 14:90616764-90616786 GCAGAGACCAGCAGGGAGGGAGG - Intronic
1121437221 14:93927752-93927774 GAGGCTACCACCAGGGAGGAAGG + Intronic
1121545170 14:94757906-94757928 CTGGAGAGCAACATGGAGCATGG + Intergenic
1121619522 14:95336628-95336650 GCAGAGACCAGCAGGGAGGAGGG - Intergenic
1121619542 14:95336730-95336752 CCAGAGACCAGCAGGGAGGAGGG - Intergenic
1121917465 14:97848866-97848888 AAGGAGACCTGCAGGGAGGAGGG - Intergenic
1122211969 14:100179137-100179159 GTGGAGTCACACAGGGTGGAGGG + Intergenic
1125828465 15:42694712-42694734 GTGGAGACCACCAGGTAGTGTGG + Exonic
1126090695 15:45048712-45048734 GTGGACACCAAGAGTGAGGTTGG + Intronic
1127141592 15:55983441-55983463 ATGGAGACGAACAGGAAGGTTGG - Intronic
1128213239 15:65916734-65916756 GTCCAGACCAGCAGGGAGGGAGG - Intronic
1128577095 15:68783731-68783753 GTCGAGGCCTACAGGAAGGAAGG - Intronic
1128873280 15:71180751-71180773 GTGGATACCAACAGGGGGTGAGG + Intronic
1129958156 15:79658172-79658194 GTGGAGAGCTAAAGGAAGGATGG + Intergenic
1130576114 15:85094671-85094693 GAGGGGACCAACGGGGAGGAAGG - Intronic
1131116630 15:89799986-89800008 AGGGGGACCCACAGGGAGGAAGG - Intronic
1132313432 15:100873926-100873948 GTGGAGACCAAGGTGGGGGATGG - Intergenic
1132382829 15:101378685-101378707 GTAGAGAACATCAGGGAAGAGGG - Intronic
1132668347 16:1091900-1091922 GGGGAGGCCAAAAGGGTGGAAGG - Intronic
1133271569 16:4613201-4613223 GTGGAGACCAGGAGGGAAGCAGG + Intronic
1133902484 16:9990369-9990391 GGGGATCCCAAAAGGGAGGAGGG + Intronic
1135303379 16:21349617-21349639 GTGGAGACCAACGGACAGGAGGG - Intergenic
1135484089 16:22848686-22848708 CAAGAGACCAGCAGGGAGGAAGG - Intronic
1136300125 16:29328811-29328833 GTGGAGACCAACGGACAGGAGGG - Intergenic
1136454844 16:30374633-30374655 CTGGAGCCCAGCGGGGAGGAAGG - Intronic
1137973461 16:53009259-53009281 TTGGAAACCAAAAGGGAGTAGGG - Intergenic
1138217152 16:55214467-55214489 GAGGAGAAGAACAGGAAGGAGGG + Intergenic
1139986239 16:70900593-70900615 GTTGGGAGCAACAGGGTGGAGGG + Intronic
1140024362 16:71271084-71271106 TGGGAAGCCAACAGGGAGGATGG + Intergenic
1140953916 16:79845024-79845046 GGGGAGGCCAAAAGGGAGCAGGG + Intergenic
1141459571 16:84170029-84170051 GTGGAGGCTAAAAGAGAGGATGG + Exonic
1141524679 16:84603981-84604003 GTGGGGGCCATCAGGGAGGGAGG - Intronic
1141594401 16:85088598-85088620 GATGAGACCAAGAGGGAGGAGGG + Exonic
1142029134 16:87829735-87829757 GTGGAGACCACCGGGGAGGAGGG - Intergenic
1142061858 16:88035581-88035603 GTGGAGACCAACGGACAGGAGGG - Intronic
1142809472 17:2388533-2388555 GTGCAGACCAGCAGCCAGGAGGG - Intronic
1142906247 17:3044197-3044219 GTGGGGACCAGCAGACAGGAAGG - Intergenic
1144093637 17:11880645-11880667 GTGGAGAGGAAAAGAGAGGAAGG + Intronic
1144791218 17:17860438-17860460 GTGAAGACCAGCATGGATGAGGG + Intronic
1144967526 17:19087440-19087462 GTGGAAAGCAGCAGGGAAGAGGG - Intergenic
1144980393 17:19164625-19164647 GTGGAAAGCAGCAGGGAAGAGGG + Intergenic
1144987829 17:19213607-19213629 GTGGAAAGCAGCAGGGAAGAGGG - Intergenic
1145910012 17:28537035-28537057 GTGAAGATTGACAGGGAGGAGGG + Intronic
1147970204 17:44215342-44215364 GCGGAGCCTAACAGTGAGGATGG + Intronic
1148492537 17:48032603-48032625 CAGGAGAAAAACAGGGAGGAAGG + Intronic
1149550013 17:57533127-57533149 ACAGAGACCAACAGGGAGCAGGG - Intronic
1149568637 17:57656702-57656724 GTGGAGACAGAAAGGGAGGTCGG + Intronic
1151210230 17:72538936-72538958 CTGGAGAGAAACTGGGAGGAGGG + Intergenic
1151422074 17:74005229-74005251 CTGGAGACCAACTGGAGGGAGGG + Intergenic
1151899729 17:77004028-77004050 ATGAAGACCAACAGTGAAGAGGG - Intergenic
1151941068 17:77292283-77292305 ATGGAGACCAACAGGTAGAGGGG - Intronic
1152730637 17:81967951-81967973 GTGGGGACCAGCAGGCTGGACGG - Intergenic
1152809708 17:82375666-82375688 CTGGAGACCCTCAGGGAGGCGGG - Intergenic
1152904924 17:82964984-82965006 GTGCACTCCCACAGGGAGGACGG + Intronic
1152904935 17:82965025-82965047 GTGCACACCCACAGGGAGGACGG + Intronic
1156011117 18:32499189-32499211 ATGGACACCAAAAGTGAGGAGGG - Intergenic
1156297885 18:35809178-35809200 GTGGAAAACTAGAGGGAGGAAGG - Intergenic
1156310576 18:35918543-35918565 GTGGAGACCCAGAGGAGGGAAGG - Intergenic
1156490189 18:37491553-37491575 CTGGAGACCAAGAGGGACTATGG + Intronic
1157155938 18:45266125-45266147 CTTGAGACCTACAGGAAGGATGG + Intronic
1157475223 18:48019732-48019754 CTGGGGACCAGCAGAGAGGAGGG - Intergenic
1157660776 18:49441727-49441749 GGGGACACCAACAAGAAGGAAGG + Intronic
1158057234 18:53296188-53296210 GTGGAAAACAGCAGGAAGGAAGG - Intronic
1158112532 18:53956738-53956760 ATGGAGATCAACAGTGAAGAAGG + Intergenic
1159005171 18:63004663-63004685 GTGGAGACCCAGAGCCAGGAGGG + Intergenic
1159128109 18:64248287-64248309 TTGGAGACCAACAGACAGGAAGG - Intergenic
1159632518 18:70765298-70765320 ATAGAGACCTCCAGGGAGGAAGG + Intergenic
1159768644 18:72521976-72521998 GAGGAGAACAACAGGGTGGAGGG - Intergenic
1160550898 18:79693202-79693224 GTGGTGACCGGGAGGGAGGATGG + Intronic
1160767524 19:815074-815096 GTGGACACCTGCAGGGCGGAAGG + Exonic
1161299748 19:3537032-3537054 GTTGACACCATCAGGGAGGGAGG + Intronic
1161633037 19:5368799-5368821 GAAGAGTCCAACAGAGAGGAGGG - Intergenic
1162320608 19:9969075-9969097 GTGTAGACCATCAAGGTGGAAGG + Intronic
1162320625 19:9969177-9969199 GTGTAGACCATCAGGGTGGAAGG + Intronic
1163010209 19:14420494-14420516 GTGGAGGGAAAGAGGGAGGAAGG - Intergenic
1163760250 19:19132602-19132624 GTGGAGACCTTCAGGGCTGAGGG + Intronic
1164756657 19:30694881-30694903 GTGGAGGGCAAGAGTGAGGAGGG + Intronic
1165474613 19:36023354-36023376 ATGGAGACCCAGAGGCAGGAAGG - Intronic
1166015178 19:39974215-39974237 GTGGAGATTAGGAGGGAGGAAGG + Intronic
1167027099 19:46928539-46928561 CTGGAGCCAAACAGCGAGGAGGG - Intronic
1167383167 19:49150021-49150043 CTGGAGAGGAACAGGGAGGAGGG + Intronic
1168459890 19:56545688-56545710 GTGGGGACCAAGAGAGAGGGAGG + Intronic
1168535907 19:57170758-57170780 GTGGACACAAACAGTGAGGTTGG - Intergenic
925100258 2:1238285-1238307 GTGGAGAGAAAGAGAGAGGAAGG - Intronic
927464015 2:23323690-23323712 CTGCAGAGGAACAGGGAGGAAGG + Intergenic
932501316 2:72185327-72185349 GTGAAGACAGACATGGAGGAAGG - Intronic
934035859 2:88088098-88088120 GAGGAGACAGACAGGGAGGATGG - Intronic
934936886 2:98472169-98472191 GTGGAGACCTACAGGGGCCAAGG + Intronic
934945067 2:98534880-98534902 GTTGAGAACAACAGAGAAGAAGG + Intronic
935555843 2:104508744-104508766 ATGGGGACCCACATGGAGGAAGG + Intergenic
935943044 2:108261586-108261608 GTGGATGCCAACAGGGCTGATGG + Intronic
936012806 2:108936020-108936042 GTGGTGACCAGTAGGGAGGACGG - Intronic
937907963 2:127061568-127061590 GGGGAAACCATGAGGGAGGAGGG - Intronic
937990478 2:127659413-127659435 GTGGAGACCAGCAGGGAGCTGGG - Intronic
940976503 2:159951382-159951404 GTTGAGGACAACAGTGAGGAAGG + Exonic
941157595 2:161998384-161998406 TTGGAGAGCAACAAGGAGGGAGG - Intronic
941562545 2:167066235-167066257 GTTGAGAGCAACAAGGAGAAGGG - Intronic
941659358 2:168179793-168179815 GTGGAGGTCAGCAGGGAGGCTGG - Intronic
942067563 2:172285878-172285900 GCGGAGATCAAAAGGAAGGAAGG - Intergenic
942245492 2:174004144-174004166 GGGGAGCCCAATAGTGAGGAGGG + Intergenic
942752549 2:179304237-179304259 CTGGAGAACAGCAGGGAGGTGGG - Intergenic
942926361 2:181437806-181437828 AGGCAGACCCACAGGGAGGAAGG + Intergenic
943728476 2:191276642-191276664 GTGGACTTCACCAGGGAGGATGG + Intronic
943784476 2:191861913-191861935 GTGTAGACCAGGAGGCAGGAGGG - Intergenic
944396364 2:199272296-199272318 GAGGAGAACGACAGCGAGGAAGG - Exonic
944658060 2:201896782-201896804 GTGCAGAAAATCAGGGAGGATGG - Intergenic
944674718 2:202025669-202025691 GTGGATCCCAAAAGGGAGGCTGG + Intergenic
946051263 2:216864362-216864384 TTGCAGAGCAAAAGGGAGGAAGG + Intergenic
946238677 2:218340920-218340942 CTGGACACCAGCAGGGAGGGAGG + Intronic
946373410 2:219294321-219294343 GTGGAGAAAAACAGGGGAGAGGG + Intronic
947376089 2:229496625-229496647 GTGGAAACCAAAAGAGAGCAGGG + Intronic
947665257 2:231901282-231901304 GTAGAGACCAAGAAGGAGGTGGG - Intergenic
947709090 2:232300396-232300418 CTGGAGACCAAGAGTGGGGAGGG - Intronic
947805218 2:232961916-232961938 GCAGAGAGAAACAGGGAGGAGGG + Intronic
948275398 2:236704334-236704356 GTAGAGACCAACAGGTGGGGAGG + Intergenic
948540140 2:238685445-238685467 GTGCACACTACCAGGGAGGATGG - Intergenic
949044136 2:241863166-241863188 GTGGCCACCAGCAGGGAGGTGGG - Intergenic
1170540384 20:17381753-17381775 GTGGAGAAAAAAAGGGAGGGTGG - Intronic
1171426606 20:25052443-25052465 ATGGGGACCACCAGGGAGCATGG - Intronic
1172546517 20:35765994-35766016 GTGGAGAGCCAGAGGAAGGAAGG - Intergenic
1172729728 20:37076007-37076029 GTGGAGAAAAACTGGGAGGCAGG - Intronic
1173597993 20:44272148-44272170 GTGCAGAACAACATGGAGAAGGG + Intronic
1174743475 20:53039173-53039195 GTGTAGACCAAGAAGGAGAAGGG - Intronic
1175303749 20:57961474-57961496 TTGGAGATCAGCAGGGAGGAGGG - Intergenic
1175693460 20:61083208-61083230 ATGGAGGACAACAGGGAGGGGGG - Intergenic
1176123876 20:63466489-63466511 GTGGAGGCCAGGAGGGAGGATGG - Intronic
1177968056 21:27753710-27753732 GAGAAGAGCAGCAGGGAGGAAGG - Intergenic
1178072443 21:28983655-28983677 ATGGAGAGCCACAGGAAGGATGG + Intronic
1179071099 21:38071807-38071829 GTGGAGAACAAAAGGGAGAAAGG - Intronic
1179438073 21:41375593-41375615 CTGGAGACACACAGGGAGAAGGG - Intronic
1179774058 21:43648340-43648362 ATGAAGCCCAGCAGGGAGGATGG - Intronic
1179835415 21:44028597-44028619 GTGGAGACGCACAGGGATGGGGG + Intronic
1179912305 21:44456669-44456691 GTGGAGACCAGCAGGAGCGAGGG - Exonic
1179935196 21:44599531-44599553 GTGGACCCCACCAGGGAGGGAGG - Intronic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180083506 21:45497361-45497383 GTGCTGACCAACAGGAGGGACGG - Intronic
1181237380 22:21455835-21455857 GTGGAGACCAGACGGGAGGCTGG + Intergenic
1181537018 22:23551621-23551643 ATGGAGAACAAAAGGGAGAATGG - Intergenic
1182083184 22:27543521-27543543 GAGCAGAGAAACAGGGAGGAGGG - Intergenic
1182924453 22:34109248-34109270 ATGGAGACAGACAGGAAGGAAGG - Intergenic
1183225780 22:36548996-36549018 GTGAAGATCAACAGGGACGAGGG - Intergenic
1183392844 22:37555569-37555591 ATAGATACCAACATGGAGGATGG + Intergenic
1183548363 22:38467482-38467504 ATTGAGACCAAGAGAGAGGAAGG + Intergenic
1183608594 22:38882391-38882413 GTGGAGAGGAACAGGGCGCATGG + Intergenic
1183758136 22:39790004-39790026 GCAGAGACCCACAGGCAGGAGGG + Intronic
1184397862 22:44255427-44255449 GAGGAGAGCAACTGGCAGGATGG - Intronic
949115018 3:310078-310100 GAGGAGACAAACAGAGGGGATGG + Intronic
949563304 3:5222463-5222485 GTGAAGATCAACAGTGAAGAAGG + Intergenic
951593486 3:24292219-24292241 GTGGTCACCTACAGGGAGTAGGG + Intronic
951656075 3:25009859-25009881 GGGGAGACAAGCAGGAAGGAAGG + Intergenic
951664702 3:25109678-25109700 CTAGAGACCAACTGGGAGGCAGG + Intergenic
952090264 3:29876845-29876867 GTGGAGACCAACAGGTACAAAGG + Intronic
953198679 3:40756968-40756990 GTGGAGCAGAGCAGGGAGGAGGG + Intergenic
953237879 3:41121830-41121852 GTGGAGGACTACTGGGAGGAGGG + Intergenic
953240935 3:41148917-41148939 GAGCAGCCCACCAGGGAGGAAGG + Intergenic
953434336 3:42866563-42866585 GAGGAGAGCAAGAGAGAGGAAGG - Exonic
953696597 3:45164731-45164753 GGGGAGGACAACAGGGAGGCTGG + Intergenic
953945055 3:47139184-47139206 GTGGAGGCTGAGAGGGAGGAAGG - Intronic
955098120 3:55820151-55820173 GTGGAGCCCCACATGGAGGGTGG + Intronic
955322732 3:57985874-57985896 GTGGAGACCAGGATGGAGCAGGG + Intergenic
955640084 3:61073129-61073151 TTCAAGACCTACAGGGAGGAGGG - Intronic
955937361 3:64113933-64113955 GTGAACACCCACAGGGAGGTAGG + Intronic
956796341 3:72722119-72722141 CTGGGGCCCAACAGGAAGGAAGG + Intergenic
959627002 3:108463850-108463872 GGAGAGAGCAACAGAGAGGAAGG + Intronic
959871087 3:111329334-111329356 TTGAAGACCAAGAGGGATGAAGG - Intronic
960829989 3:121835613-121835635 GTTGAGACCAGCAGACAGGAAGG + Intronic
961110283 3:124277694-124277716 GTGGAGAACAGAATGGAGGAAGG + Intronic
961345475 3:126260747-126260769 TGGGAGAAGAACAGGGAGGAAGG - Intergenic
962455601 3:135562838-135562860 GTTGAGACCAGTAGGGAGAATGG + Intergenic
962809997 3:138951530-138951552 GTGGAGGCCAACTGGGAAAAAGG + Exonic
963473698 3:145776564-145776586 AGGGAGAGAAACAGGGAGGAAGG - Intergenic
964601042 3:158501670-158501692 ATGGACACCAACAGTGAGCAGGG - Intronic
965077087 3:163992884-163992906 GAGGAGACAGAGAGGGAGGAAGG + Intergenic
967409867 3:189156512-189156534 GTGAAGAGCAACTGGAAGGATGG + Intronic
967965534 3:194957302-194957324 GGGGAGACCACCAGGGTGTAAGG + Intergenic
969658478 4:8511325-8511347 GTGCAGACCACCACGGAGAAGGG - Intergenic
974347669 4:60702607-60702629 ATGTAGACTAATAGGGAGGAAGG + Intergenic
974549253 4:63349721-63349743 GTAGGCACCACCAGGGAGGATGG - Intergenic
974774025 4:66457021-66457043 GAGGAGAGCAAGAGGAAGGAGGG + Intergenic
975540649 4:75507178-75507200 CTGGAGACCTACAGGAAAGAAGG + Intronic
976816130 4:89149671-89149693 GTGAAGACACACAGGGAGGGTGG + Intergenic
978168403 4:105637253-105637275 GTGCAGAGCAACAGTGAGAACGG + Intronic
980885325 4:138756352-138756374 CTGGATACCAACAGGGAAGTTGG + Intergenic
980990283 4:139733649-139733671 CTGAAGACCTACAGGCAGGAAGG + Intronic
982026680 4:151258734-151258756 GTGAAGACCAAAGGAGAGGAGGG + Intronic
982028610 4:151277034-151277056 GTGAAGACCAAAGGAGAGGAGGG + Intronic
982555986 4:156865690-156865712 GTGAACCCCACCAGGGAGGAAGG + Intronic
983145342 4:164207635-164207657 GTGAACACCAGCAGGGAGGCAGG - Intronic
984524077 4:180836007-180836029 GTGGAGCAAAACTGGGAGGAGGG - Intergenic
985538141 5:475772-475794 GTCGGGACCCACAGAGAGGAGGG + Intronic
985567123 5:624682-624704 GCGGACACCAGGAGGGAGGAAGG + Intronic
985969760 5:3365793-3365815 GTGGAGCCCAGCGGGGAGGTGGG - Intergenic
986484145 5:8218251-8218273 GTTATGAGCAACAGGGAGGAAGG - Intergenic
986673851 5:10166974-10166996 GAGGAGACACACAGGGAAGAAGG + Intergenic
987379941 5:17275631-17275653 GAGGAGCCCAGCAAGGAGGAAGG + Exonic
988211872 5:28214456-28214478 TTGCAGGCCAACAGTGAGGAGGG - Intergenic
989566808 5:42909272-42909294 GTGGATACTAACAGGGTGGGAGG - Intergenic
990310540 5:54533882-54533904 GTGGAGACCAACAGGGAGGAAGG + Intronic
990763425 5:59155801-59155823 GCTGAGACCAGAAGGGAGGAAGG + Intronic
992120285 5:73585617-73585639 GTGGTGACCAACAAGGTGGGAGG + Intergenic
994491806 5:100456915-100456937 GTAGAGAAAAACAGGGAGAATGG - Intergenic
994850913 5:105053779-105053801 AGTGAGACCAACAGAGAGGAGGG - Intergenic
996266770 5:121550641-121550663 GTGGAGACCACAAGGGAAGCCGG + Intergenic
996663219 5:126027872-126027894 GTGAACACCCACAGGGAGGCAGG + Intergenic
996688716 5:126313938-126313960 CTGGATTCCAAGAGGGAGGAGGG + Intergenic
996911371 5:128660615-128660637 GTGGAAACCAACAAGGACTAGGG - Intronic
997720814 5:136077145-136077167 GAGGAGCCAAACAGGGAGCAGGG + Intergenic
998292284 5:140926874-140926896 GTGGACGCCTAGAGGGAGGATGG + Exonic
998777024 5:145615226-145615248 ATGGAGACCAAAAGCGAGCAGGG - Intronic
998941085 5:147282612-147282634 ATGGACACCAAAAGCGAGGAGGG + Intronic
999153345 5:149441372-149441394 CTGGAGGCCACCAGGGTGGAGGG + Intergenic
999410446 5:151345581-151345603 GTGGACACCCACAGGGAGAAAGG - Intronic
1000309668 5:160029914-160029936 GTGGGGCCCACCAGAGAGGAGGG + Intronic
1000335021 5:160235687-160235709 CTGGAGAGCTTCAGGGAGGAGGG - Intronic
1000364286 5:160476782-160476804 GTGGAAAACAGCTGGGAGGAGGG - Intergenic
1000706645 5:164521057-164521079 GTGGTGAGGTACAGGGAGGATGG - Intergenic
1001344231 5:170876232-170876254 GGGGTAACCCACAGGGAGGAGGG - Intronic
1001822078 5:174718349-174718371 GTGGAGGCAGAAAGGGAGGAGGG + Intergenic
1002052589 5:176579720-176579742 GTGGAGACTGGCTGGGAGGAAGG + Intronic
1002338727 5:178500061-178500083 GTGGGGAGGTACAGGGAGGAAGG + Intronic
1003745404 6:8995961-8995983 GGGGACTCCAAAAGGGAGGAGGG - Intergenic
1004160226 6:13206143-13206165 GTGGGCACCAGGAGGGAGGACGG + Intronic
1006379547 6:33689515-33689537 TGGGAGCCCAACAGAGAGGAGGG - Intronic
1006947039 6:37791540-37791562 GTGCAGAGTTACAGGGAGGAGGG + Intergenic
1007493223 6:42240576-42240598 GTTGAGACCCAGAGAGAGGAAGG - Intronic
1008716407 6:54295170-54295192 GTGAATACCAGCATGGAGGATGG - Intergenic
1009803073 6:68567344-68567366 GAGGACTCCAAAAGGGAGGAGGG - Intergenic
1011602561 6:89073385-89073407 GTGGACACCAAGAGTGAGGTGGG - Intergenic
1013038702 6:106412197-106412219 GTGGTGCCCCACAGTGAGGAAGG - Intergenic
1013633094 6:112003814-112003836 GGGGAGAAAAACAGGGAGGGAGG + Intergenic
1014079754 6:117272361-117272383 GCAGAGACCTACAGGGAAGAAGG - Intronic
1016964825 6:149709204-149709226 CTGAATTCCAACAGGGAGGAGGG - Intronic
1017262350 6:152402015-152402037 CAGGAGACCAACAGTGTGGAAGG + Intronic
1018111890 6:160544478-160544500 GGGGAGAGCAAGAGGGAAGAAGG - Intronic
1018131368 6:160735037-160735059 AGGGACACCAAGAGGGAGGAAGG + Intronic
1018632849 6:165835514-165835536 GCTTAGACCAGCAGGGAGGAAGG - Intronic
1018934010 6:168261434-168261456 GGGGAGACCACCAGGGTGGGAGG + Intergenic
1019046013 6:169146782-169146804 GTGGACACCAAGAAGGGGGAGGG - Intergenic
1019138669 6:169929275-169929297 GACAAGGCCAACAGGGAGGATGG + Intergenic
1019138685 6:169929357-169929379 GGGGAGGTCAACAGTGAGGATGG + Intergenic
1019138689 6:169929379-169929401 GGGAAGTCCAACAGTGAGGATGG + Intergenic
1019138730 6:169929593-169929615 GATGAAGCCAACAGGGAGGATGG + Intergenic
1019138779 6:169929840-169929862 GGGGAGGTCAACAGTGAGGATGG + Intergenic
1019138784 6:169929861-169929883 GGGGAGGTCAACAGTGAGGATGG + Intergenic
1019138813 6:169930006-169930028 GTGGAGGTCAACAGTGAGGATGG + Intergenic
1019153557 6:170024209-170024231 GTGGAGACCACCCGCGAGGCTGG + Intergenic
1019388008 7:769387-769409 ATGGAGACTTACAGGGAGGCGGG + Intronic
1019479715 7:1260994-1261016 GTGGAGAACGCCAGGGAGGGAGG - Intergenic
1020011341 7:4807506-4807528 GGGGAGACGGAGAGGGAGGAGGG - Intronic
1021280259 7:18708282-18708304 ATGGAGAAAAAGAGGGAGGAAGG + Intronic
1021292856 7:18867143-18867165 GTGGAGACATGCAGGGAAGAAGG + Intronic
1022015417 7:26345012-26345034 GTGAAGACGAAGACGGAGGAGGG - Intronic
1022114184 7:27248281-27248303 GTGGAGGACAGCAGGGAGGAAGG + Intergenic
1022542829 7:31154078-31154100 GGGGACACAAACAGGGCGGAAGG + Intergenic
1023670860 7:42575195-42575217 GTGGTGACCAAGATGGTGGATGG + Intergenic
1024343279 7:48288237-48288259 GGAGAGGCCAAGAGGGAGGAAGG - Intronic
1025108576 7:56193696-56193718 GTGGAGACCCATGGGGAGGGAGG + Intergenic
1026467089 7:70663439-70663461 GTGGAGCCCCACAGGAAGAAAGG + Intronic
1026677617 7:72441249-72441271 GAGCAGACCTACAGGGAGGTGGG + Intronic
1027139289 7:75645928-75645950 GGGGACTCCAAAAGGGAGGAGGG + Intronic
1028083103 7:86601150-86601172 GTGAATACCCACAGGGAGGCAGG + Intergenic
1028396104 7:90369994-90370016 TTGGAGACTCAGAGGGAGGAAGG + Intronic
1028870405 7:95765361-95765383 CTGGAAACTAAGAGGGAGGAGGG + Intergenic
1028929237 7:96394705-96394727 ATGGAAACCAAAAGGGAGCAGGG - Intergenic
1028994618 7:97086116-97086138 GTGGAGAATGACAGGGAGTAGGG + Intergenic
1029587900 7:101487060-101487082 GTGGAGACAGACAGGGAAGCTGG + Intronic
1030605340 7:111633649-111633671 GTGCAGCACACCAGGGAGGAGGG - Intergenic
1031589989 7:123579064-123579086 GAGGACACCAAAAGGGAGGAAGG - Intronic
1032186590 7:129732017-129732039 CTGGGGACCAGCAGAGAGGAAGG - Intronic
1033073249 7:138223997-138224019 GTGGACACCAAAAGTGAGGTTGG - Intergenic
1034867626 7:154655820-154655842 GTGGAGACCCTCAGAGAGCAAGG - Intronic
1035319937 7:158022300-158022322 GTGGAGGCCGTCAGGAAGGATGG - Intronic
1036219021 8:6905042-6905064 GTGGAGACCAACTGAGTGGCTGG - Intergenic
1036221646 8:6926000-6926022 GAGGAGAACAGCAGTGAGGATGG + Exonic
1036598123 8:10232249-10232271 GTGGAAACCAACAGGGAGGCTGG - Intronic
1036621013 8:10424585-10424607 GTGGAGAGGGACAGGGAGAAGGG + Intronic
1037902743 8:22697145-22697167 GAGGAAACCAGGAGGGAGGAAGG - Intergenic
1038254545 8:25939020-25939042 GTGTAGAACAACAGGGAAAAGGG - Intronic
1040581954 8:48705533-48705555 GTGGAGAAAAACAGCCAGGAGGG + Intergenic
1041584931 8:59505371-59505393 GGGGACTCCAAAAGGGAGGAAGG + Intergenic
1041811795 8:61919635-61919657 CTGGCCACCAACAGGGAGGGAGG + Intergenic
1041896957 8:62936285-62936307 GTGGATGCCAACAGGAAAGATGG - Intronic
1042962706 8:74320908-74320930 GTGGAGACCTACGGGGACGGAGG - Exonic
1043392147 8:79802189-79802211 TTGGTGTCCAGCAGGGAGGAAGG - Intergenic
1046157217 8:110308419-110308441 GGGGAGGCAAAGAGGGAGGATGG + Intergenic
1047385830 8:124408294-124408316 GTGAAGAGCAAAAGGGAGCATGG - Intergenic
1047819105 8:128499040-128499062 CTGGAGACCAAAAGGGACAATGG + Intergenic
1048864087 8:138746655-138746677 GTGCAGAGCAACACAGAGGATGG - Intronic
1049441771 8:142612872-142612894 GTGGAGCCCTGCAGGGGGGAGGG + Exonic
1050233658 9:3555659-3555681 GTGGCCACCCACATGGAGGATGG + Intergenic
1050263328 9:3863888-3863910 GTGGAAAGAAAAAGGGAGGAGGG + Intronic
1050406151 9:5310366-5310388 GGGGAGAGGTACAGGGAGGAAGG - Intergenic
1051336941 9:16074191-16074213 GTGGAAACCAACAAGAAGCAAGG - Intergenic
1051936234 9:22446697-22446719 GTGGGGACCTTCTGGGAGGAGGG - Intergenic
1051963715 9:22800754-22800776 GTGGAGCCCAAGACTGAGGAAGG + Intergenic
1053142733 9:35691137-35691159 GTGGAGAGCCGCCGGGAGGAGGG + Intergenic
1056395110 9:86174824-86174846 GTGTAAGGCAACAGGGAGGATGG - Intergenic
1056511013 9:87305697-87305719 GTGGAGACCAACAGTAATGGTGG + Intergenic
1056846367 9:90041241-90041263 GTGGAGACCAACACAGGGAATGG + Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057263450 9:93598885-93598907 GTGGAGGCCAACAGGAAGGGAGG - Intronic
1057995284 9:99817333-99817355 GTGGAGAAGAAGAGGAAGGAGGG + Intergenic
1058971699 9:110089134-110089156 GTGCAGAGCAATAGGGAGAAAGG + Intronic
1059182138 9:112226283-112226305 CTGGAGACCAGCAGGGAGGCCGG + Intronic
1059437084 9:114283525-114283547 GTGGGGAACTCCAGGGAGGAGGG + Intronic
1060621098 9:125067431-125067453 GTGAAGACAGACAGGAAGGAAGG + Intronic
1061225981 9:129281263-129281285 GTGGAGACCAGCTGGGATGGCGG - Intergenic
1061406642 9:130396053-130396075 GTGGAGATCCACAGTGAGTAGGG + Intronic
1061862277 9:133474096-133474118 GGGGAGACCACCAGGGCTGAGGG + Intronic
1062268469 9:135698210-135698232 GTGGAGACCCAGAGGGCTGAAGG + Intronic
1062560569 9:137139833-137139855 GTGGTGTCTTACAGGGAGGAAGG - Intronic
1186143038 X:6597157-6597179 ATGGAAATTAACAGGGAGGATGG + Intergenic
1186750761 X:12619488-12619510 GTGGAGCCCAAGACTGAGGAGGG + Intronic
1188029914 X:25252801-25252823 GAGGAGACATACAGGGAAGAAGG + Intergenic
1188060999 X:25601964-25601986 GGGGAATACAACAGGGAGGAGGG - Intergenic
1188606802 X:32041313-32041335 GTGGAGATCACCAGGAAGGGGGG - Intronic
1188776987 X:34231761-34231783 GTGGAGACAAACATGGATTAAGG - Intergenic
1188838690 X:34989077-34989099 GTGGTGGCGAACAGGGAAGAAGG - Intergenic
1191945665 X:66531815-66531837 GTGGAGCCCAAGACTGAGGAAGG - Intergenic
1192256835 X:69468585-69468607 GTAGATAACAACAGTGAGGAGGG + Intergenic
1192340099 X:70257290-70257312 CAGGAGACCAACAGGCTGGAAGG + Intergenic
1193083513 X:77427987-77428009 GTGGAGAACATCTGGGAAGATGG - Intergenic
1194055417 X:89126700-89126722 GTGGATGCCCACAGGGAGGCAGG - Intergenic
1194925704 X:99820424-99820446 GTGAACACCCACAGGGAGGCAGG + Intergenic
1198169220 X:134089434-134089456 GGGGATTCCAAAAGGGAGGAAGG + Intergenic
1199257573 X:145734081-145734103 GTGAAGAGCAACAGGAAGGATGG + Intergenic
1199496398 X:148457417-148457439 GTGGAGACCAAGTGGTTGGAGGG - Intergenic
1199977700 X:152904126-152904148 CTGGAGGCCAACAGGGTGGCAGG - Intergenic
1199995397 X:153021598-153021620 GTGGTGAACAGGAGGGAGGAGGG - Intergenic
1200374214 X:155762513-155762535 GTGGAGGCTAACAGAGAGAAAGG + Intergenic
1201566095 Y:15366742-15366764 GTGGACACCAACAAGGACAAGGG + Intergenic