ID: 990313393

View in Genome Browser
Species Human (GRCh38)
Location 5:54561425-54561447
Sequence AAGGACCTCTTGAGCTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990313393_990313403 21 Left 990313393 5:54561425-54561447 CCTCCTGAGCTCAAGAGGTCCTT No data
Right 990313403 5:54561469-54561491 CTGGGATTAGAGGCACACACCGG No data
990313393_990313398 3 Left 990313393 5:54561425-54561447 CCTCCTGAGCTCAAGAGGTCCTT No data
Right 990313398 5:54561451-54561473 CCTCAGCCTCCCAAGTAACTGGG 0: 2835
1: 101216
2: 211662
3: 252465
4: 268723
990313393_990313400 11 Left 990313393 5:54561425-54561447 CCTCCTGAGCTCAAGAGGTCCTT No data
Right 990313400 5:54561459-54561481 TCCCAAGTAACTGGGATTAGAGG 0: 18
1: 2179
2: 60988
3: 160601
4: 272817
990313393_990313396 2 Left 990313393 5:54561425-54561447 CCTCCTGAGCTCAAGAGGTCCTT No data
Right 990313396 5:54561450-54561472 ACCTCAGCCTCCCAAGTAACTGG 0: 548
1: 16514
2: 118605
3: 229726
4: 286624

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990313393 Original CRISPR AAGGACCTCTTGAGCTCAGG AGG (reversed) Intergenic
No off target data available for this crispr