ID: 990315153

View in Genome Browser
Species Human (GRCh38)
Location 5:54576642-54576664
Sequence CACTGCTACTGTAATAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990315153_990315156 -6 Left 990315153 5:54576642-54576664 CCCACTTTATTACAGTAGCAGTG No data
Right 990315156 5:54576659-54576681 GCAGTGTGAACTTCAAGGCATGG No data
990315153_990315157 9 Left 990315153 5:54576642-54576664 CCCACTTTATTACAGTAGCAGTG No data
Right 990315157 5:54576674-54576696 AGGCATGGCTGAATGTTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990315153 Original CRISPR CACTGCTACTGTAATAAAGT GGG (reversed) Intergenic
No off target data available for this crispr