ID: 990315541

View in Genome Browser
Species Human (GRCh38)
Location 5:54579526-54579548
Sequence CTCTGTAAATAGATGGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990315541_990315544 -1 Left 990315541 5:54579526-54579548 CCTTCATCCATCTATTTACAGAG No data
Right 990315544 5:54579548-54579570 GTCACTGGTTCACTTGCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990315541 Original CRISPR CTCTGTAAATAGATGGATGA AGG (reversed) Intergenic
No off target data available for this crispr