ID: 990317858

View in Genome Browser
Species Human (GRCh38)
Location 5:54601077-54601099
Sequence ATGGACAGACAGAGGGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990317858_990317868 20 Left 990317858 5:54601077-54601099 CCGTCCTCCCTCTGTCTGTCCAT No data
Right 990317868 5:54601120-54601142 CCATCCATGTAGTGATGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990317858 Original CRISPR ATGGACAGACAGAGGGAGGA CGG (reversed) Intergenic
No off target data available for this crispr