ID: 990319036

View in Genome Browser
Species Human (GRCh38)
Location 5:54611766-54611788
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990319023_990319036 23 Left 990319023 5:54611720-54611742 CCTTTATCTGGTAAAAGAAAGGA No data
Right 990319036 5:54611766-54611788 TGATGGGGAAGCAACTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr