ID: 990322052

View in Genome Browser
Species Human (GRCh38)
Location 5:54639813-54639835
Sequence CAGCCTAATCACTTAACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990322052_990322055 -3 Left 990322052 5:54639813-54639835 CCTGGGGTTAAGTGATTAGGCTG No data
Right 990322055 5:54639833-54639855 CTGACCAAGGAGGTTATGCAAGG No data
990322052_990322059 25 Left 990322052 5:54639813-54639835 CCTGGGGTTAAGTGATTAGGCTG No data
Right 990322059 5:54639861-54639883 ATGTATCAGCAAAAGCCAGGTGG No data
990322052_990322060 26 Left 990322052 5:54639813-54639835 CCTGGGGTTAAGTGATTAGGCTG No data
Right 990322060 5:54639862-54639884 TGTATCAGCAAAAGCCAGGTGGG No data
990322052_990322056 -2 Left 990322052 5:54639813-54639835 CCTGGGGTTAAGTGATTAGGCTG No data
Right 990322056 5:54639834-54639856 TGACCAAGGAGGTTATGCAAGGG No data
990322052_990322058 22 Left 990322052 5:54639813-54639835 CCTGGGGTTAAGTGATTAGGCTG No data
Right 990322058 5:54639858-54639880 ATTATGTATCAGCAAAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990322052 Original CRISPR CAGCCTAATCACTTAACCCC AGG (reversed) Intergenic
No off target data available for this crispr