ID: 990322054

View in Genome Browser
Species Human (GRCh38)
Location 5:54639823-54639845
Sequence AGTGATTAGGCTGACCAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990322050_990322054 -10 Left 990322050 5:54639810-54639832 CCTCCTGGGGTTAAGTGATTAGG No data
Right 990322054 5:54639823-54639845 AGTGATTAGGCTGACCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990322054 Original CRISPR AGTGATTAGGCTGACCAAGG AGG Intergenic
No off target data available for this crispr