ID: 990322056

View in Genome Browser
Species Human (GRCh38)
Location 5:54639834-54639856
Sequence TGACCAAGGAGGTTATGCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990322050_990322056 1 Left 990322050 5:54639810-54639832 CCTCCTGGGGTTAAGTGATTAGG No data
Right 990322056 5:54639834-54639856 TGACCAAGGAGGTTATGCAAGGG No data
990322052_990322056 -2 Left 990322052 5:54639813-54639835 CCTGGGGTTAAGTGATTAGGCTG No data
Right 990322056 5:54639834-54639856 TGACCAAGGAGGTTATGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990322056 Original CRISPR TGACCAAGGAGGTTATGCAA GGG Intergenic
No off target data available for this crispr