ID: 990322057

View in Genome Browser
Species Human (GRCh38)
Location 5:54639837-54639859
Sequence ATGCCCTTGCATAACCTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990322057_990322059 1 Left 990322057 5:54639837-54639859 CCAAGGAGGTTATGCAAGGGCAT No data
Right 990322059 5:54639861-54639883 ATGTATCAGCAAAAGCCAGGTGG No data
990322057_990322063 26 Left 990322057 5:54639837-54639859 CCAAGGAGGTTATGCAAGGGCAT No data
Right 990322063 5:54639886-54639908 AATGAGTGAAAGTAAGCTGTGGG No data
990322057_990322058 -2 Left 990322057 5:54639837-54639859 CCAAGGAGGTTATGCAAGGGCAT No data
Right 990322058 5:54639858-54639880 ATTATGTATCAGCAAAAGCCAGG No data
990322057_990322060 2 Left 990322057 5:54639837-54639859 CCAAGGAGGTTATGCAAGGGCAT No data
Right 990322060 5:54639862-54639884 TGTATCAGCAAAAGCCAGGTGGG No data
990322057_990322062 25 Left 990322057 5:54639837-54639859 CCAAGGAGGTTATGCAAGGGCAT No data
Right 990322062 5:54639885-54639907 CAATGAGTGAAAGTAAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990322057 Original CRISPR ATGCCCTTGCATAACCTCCT TGG (reversed) Intergenic
No off target data available for this crispr