ID: 990322058

View in Genome Browser
Species Human (GRCh38)
Location 5:54639858-54639880
Sequence ATTATGTATCAGCAAAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990322050_990322058 25 Left 990322050 5:54639810-54639832 CCTCCTGGGGTTAAGTGATTAGG No data
Right 990322058 5:54639858-54639880 ATTATGTATCAGCAAAAGCCAGG No data
990322057_990322058 -2 Left 990322057 5:54639837-54639859 CCAAGGAGGTTATGCAAGGGCAT No data
Right 990322058 5:54639858-54639880 ATTATGTATCAGCAAAAGCCAGG No data
990322052_990322058 22 Left 990322052 5:54639813-54639835 CCTGGGGTTAAGTGATTAGGCTG No data
Right 990322058 5:54639858-54639880 ATTATGTATCAGCAAAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990322058 Original CRISPR ATTATGTATCAGCAAAAGCC AGG Intergenic
No off target data available for this crispr