ID: 990323313

View in Genome Browser
Species Human (GRCh38)
Location 5:54649903-54649925
Sequence CATTGATTCTAGGGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990323305_990323313 21 Left 990323305 5:54649859-54649881 CCATCGGGGTCACACTTCATCAC No data
Right 990323313 5:54649903-54649925 CATTGATTCTAGGGGGAAGATGG No data
990323304_990323313 22 Left 990323304 5:54649858-54649880 CCCATCGGGGTCACACTTCATCA No data
Right 990323313 5:54649903-54649925 CATTGATTCTAGGGGGAAGATGG No data
990323303_990323313 23 Left 990323303 5:54649857-54649879 CCCCATCGGGGTCACACTTCATC No data
Right 990323313 5:54649903-54649925 CATTGATTCTAGGGGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990323313 Original CRISPR CATTGATTCTAGGGGGAAGA TGG Intergenic
No off target data available for this crispr