ID: 990326079

View in Genome Browser
Species Human (GRCh38)
Location 5:54676634-54676656
Sequence GTGCTGTACTTGGGCAACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990326079_990326083 11 Left 990326079 5:54676634-54676656 CCTGAGTTGCCCAAGTACAGCAC No data
Right 990326083 5:54676668-54676690 AAATCAAAGGCTCTCAAACCTGG No data
990326079_990326084 15 Left 990326079 5:54676634-54676656 CCTGAGTTGCCCAAGTACAGCAC No data
Right 990326084 5:54676672-54676694 CAAAGGCTCTCAAACCTGGAAGG No data
990326079_990326082 -2 Left 990326079 5:54676634-54676656 CCTGAGTTGCCCAAGTACAGCAC No data
Right 990326082 5:54676655-54676677 ACAGTGAGCATGAAAATCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990326079 Original CRISPR GTGCTGTACTTGGGCAACTC AGG (reversed) Intergenic
No off target data available for this crispr