ID: 990326137

View in Genome Browser
Species Human (GRCh38)
Location 5:54677214-54677236
Sequence TAAACCATGTTTCCTAGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990326137_990326143 25 Left 990326137 5:54677214-54677236 CCCTTTCTAGGAAACATGGTTTA No data
Right 990326143 5:54677262-54677284 ACTACAGTGCCTGGCATAAAGGG No data
990326137_990326142 24 Left 990326137 5:54677214-54677236 CCCTTTCTAGGAAACATGGTTTA No data
Right 990326142 5:54677261-54677283 TACTACAGTGCCTGGCATAAAGG No data
990326137_990326144 26 Left 990326137 5:54677214-54677236 CCCTTTCTAGGAAACATGGTTTA No data
Right 990326144 5:54677263-54677285 CTACAGTGCCTGGCATAAAGGGG No data
990326137_990326140 16 Left 990326137 5:54677214-54677236 CCCTTTCTAGGAAACATGGTTTA No data
Right 990326140 5:54677253-54677275 AAAGTGCCTACTACAGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990326137 Original CRISPR TAAACCATGTTTCCTAGAAA GGG (reversed) Intergenic
No off target data available for this crispr