ID: 990326138

View in Genome Browser
Species Human (GRCh38)
Location 5:54677215-54677237
Sequence TTAAACCATGTTTCCTAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990326138_990326140 15 Left 990326138 5:54677215-54677237 CCTTTCTAGGAAACATGGTTTAA No data
Right 990326140 5:54677253-54677275 AAAGTGCCTACTACAGTGCCTGG No data
990326138_990326143 24 Left 990326138 5:54677215-54677237 CCTTTCTAGGAAACATGGTTTAA No data
Right 990326143 5:54677262-54677284 ACTACAGTGCCTGGCATAAAGGG No data
990326138_990326144 25 Left 990326138 5:54677215-54677237 CCTTTCTAGGAAACATGGTTTAA No data
Right 990326144 5:54677263-54677285 CTACAGTGCCTGGCATAAAGGGG No data
990326138_990326142 23 Left 990326138 5:54677215-54677237 CCTTTCTAGGAAACATGGTTTAA No data
Right 990326142 5:54677261-54677283 TACTACAGTGCCTGGCATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990326138 Original CRISPR TTAAACCATGTTTCCTAGAA AGG (reversed) Intergenic
No off target data available for this crispr