ID: 990326139

View in Genome Browser
Species Human (GRCh38)
Location 5:54677245-54677267
Sequence TGTAGTAGGCACTTTACTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990326139_990326142 -7 Left 990326139 5:54677245-54677267 CCTCAAGTAAAGTGCCTACTACA No data
Right 990326142 5:54677261-54677283 TACTACAGTGCCTGGCATAAAGG No data
990326139_990326144 -5 Left 990326139 5:54677245-54677267 CCTCAAGTAAAGTGCCTACTACA No data
Right 990326144 5:54677263-54677285 CTACAGTGCCTGGCATAAAGGGG No data
990326139_990326143 -6 Left 990326139 5:54677245-54677267 CCTCAAGTAAAGTGCCTACTACA No data
Right 990326143 5:54677262-54677284 ACTACAGTGCCTGGCATAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990326139 Original CRISPR TGTAGTAGGCACTTTACTTG AGG (reversed) Intergenic
No off target data available for this crispr