ID: 990326144

View in Genome Browser
Species Human (GRCh38)
Location 5:54677263-54677285
Sequence CTACAGTGCCTGGCATAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990326139_990326144 -5 Left 990326139 5:54677245-54677267 CCTCAAGTAAAGTGCCTACTACA No data
Right 990326144 5:54677263-54677285 CTACAGTGCCTGGCATAAAGGGG No data
990326137_990326144 26 Left 990326137 5:54677214-54677236 CCCTTTCTAGGAAACATGGTTTA No data
Right 990326144 5:54677263-54677285 CTACAGTGCCTGGCATAAAGGGG No data
990326138_990326144 25 Left 990326138 5:54677215-54677237 CCTTTCTAGGAAACATGGTTTAA No data
Right 990326144 5:54677263-54677285 CTACAGTGCCTGGCATAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990326144 Original CRISPR CTACAGTGCCTGGCATAAAG GGG Intergenic
No off target data available for this crispr