ID: 990328278

View in Genome Browser
Species Human (GRCh38)
Location 5:54699348-54699370
Sequence ATGGAGAAGAATCACCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990328278_990328281 1 Left 990328278 5:54699348-54699370 CCAAGATGGTGATTCTTCTCCAT No data
Right 990328281 5:54699372-54699394 CCTACCTGTCCCTTGCCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990328278 Original CRISPR ATGGAGAAGAATCACCATCT TGG (reversed) Intergenic
No off target data available for this crispr