ID: 990330282

View in Genome Browser
Species Human (GRCh38)
Location 5:54719146-54719168
Sequence ATACATACATAGAATTATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990330282_990330285 15 Left 990330282 5:54719146-54719168 CCTTTATAATTCTATGTATGTAT No data
Right 990330285 5:54719184-54719206 TAAAAACATTCTTCTGAGAGGGG No data
990330282_990330286 24 Left 990330282 5:54719146-54719168 CCTTTATAATTCTATGTATGTAT No data
Right 990330286 5:54719193-54719215 TCTTCTGAGAGGGGATCCATAGG No data
990330282_990330284 14 Left 990330282 5:54719146-54719168 CCTTTATAATTCTATGTATGTAT No data
Right 990330284 5:54719183-54719205 TTAAAAACATTCTTCTGAGAGGG No data
990330282_990330283 13 Left 990330282 5:54719146-54719168 CCTTTATAATTCTATGTATGTAT No data
Right 990330283 5:54719182-54719204 TTTAAAAACATTCTTCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990330282 Original CRISPR ATACATACATAGAATTATAA AGG (reversed) Intergenic
No off target data available for this crispr