ID: 990332103

View in Genome Browser
Species Human (GRCh38)
Location 5:54738420-54738442
Sequence CCCAGCAGCCTGGTTTTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990332103_990332115 16 Left 990332103 5:54738420-54738442 CCTCTTAAAACCAGGCTGCTGGG No data
Right 990332115 5:54738459-54738481 CTCTCTCCATGGGGCTAGGTTGG No data
990332103_990332116 17 Left 990332103 5:54738420-54738442 CCTCTTAAAACCAGGCTGCTGGG No data
Right 990332116 5:54738460-54738482 TCTCTCCATGGGGCTAGGTTGGG No data
990332103_990332109 6 Left 990332103 5:54738420-54738442 CCTCTTAAAACCAGGCTGCTGGG No data
Right 990332109 5:54738449-54738471 GGTCTAGCCCCTCTCTCCATGGG No data
990332103_990332108 5 Left 990332103 5:54738420-54738442 CCTCTTAAAACCAGGCTGCTGGG No data
Right 990332108 5:54738448-54738470 GGGTCTAGCCCCTCTCTCCATGG No data
990332103_990332117 18 Left 990332103 5:54738420-54738442 CCTCTTAAAACCAGGCTGCTGGG No data
Right 990332117 5:54738461-54738483 CTCTCCATGGGGCTAGGTTGGGG No data
990332103_990332111 12 Left 990332103 5:54738420-54738442 CCTCTTAAAACCAGGCTGCTGGG No data
Right 990332111 5:54738455-54738477 GCCCCTCTCTCCATGGGGCTAGG No data
990332103_990332110 7 Left 990332103 5:54738420-54738442 CCTCTTAAAACCAGGCTGCTGGG No data
Right 990332110 5:54738450-54738472 GTCTAGCCCCTCTCTCCATGGGG No data
990332103_990332119 30 Left 990332103 5:54738420-54738442 CCTCTTAAAACCAGGCTGCTGGG No data
Right 990332119 5:54738473-54738495 CTAGGTTGGGGAGCAGCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990332103 Original CRISPR CCCAGCAGCCTGGTTTTAAG AGG (reversed) Intergenic