ID: 990332336

View in Genome Browser
Species Human (GRCh38)
Location 5:54740278-54740300
Sequence CTGAGTGAGCAGAGAGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990332336_990332341 22 Left 990332336 5:54740278-54740300 CCCTCATCTCTCTGCTCACTCAG No data
Right 990332341 5:54740323-54740345 ACCAGCTTTCTTCAAATCCCTGG No data
990332336_990332344 24 Left 990332336 5:54740278-54740300 CCCTCATCTCTCTGCTCACTCAG No data
Right 990332344 5:54740325-54740347 CAGCTTTCTTCAAATCCCTGGGG No data
990332336_990332345 25 Left 990332336 5:54740278-54740300 CCCTCATCTCTCTGCTCACTCAG No data
Right 990332345 5:54740326-54740348 AGCTTTCTTCAAATCCCTGGGGG No data
990332336_990332343 23 Left 990332336 5:54740278-54740300 CCCTCATCTCTCTGCTCACTCAG No data
Right 990332343 5:54740324-54740346 CCAGCTTTCTTCAAATCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990332336 Original CRISPR CTGAGTGAGCAGAGAGATGA GGG (reversed) Intergenic
No off target data available for this crispr