ID: 990332602

View in Genome Browser
Species Human (GRCh38)
Location 5:54742512-54742534
Sequence CGTGTGGGTGGAGCACCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990332602_990332612 29 Left 990332602 5:54742512-54742534 CCTGGGGGTGCTCCACCCACACG No data
Right 990332612 5:54742564-54742586 TGCACCCTTCCGGGTTTCTGTGG No data
990332602_990332608 19 Left 990332602 5:54742512-54742534 CCTGGGGGTGCTCCACCCACACG No data
Right 990332608 5:54742554-54742576 TCCAGCTCCGTGCACCCTTCCGG No data
990332602_990332610 20 Left 990332602 5:54742512-54742534 CCTGGGGGTGCTCCACCCACACG No data
Right 990332610 5:54742555-54742577 CCAGCTCCGTGCACCCTTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990332602 Original CRISPR CGTGTGGGTGGAGCACCCCC AGG (reversed) Intergenic
No off target data available for this crispr