ID: 990334867

View in Genome Browser
Species Human (GRCh38)
Location 5:54762698-54762720
Sequence CCAACTTTGGAGATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990334867_990334873 6 Left 990334867 5:54762698-54762720 CCTTCCTCCATCTCCAAAGTTGG No data
Right 990334873 5:54762727-54762749 AGCATCTTCAAATCTCTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990334867 Original CRISPR CCAACTTTGGAGATGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr