ID: 990335794

View in Genome Browser
Species Human (GRCh38)
Location 5:54771360-54771382
Sequence ATAATAACACTGCCTGCATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990335794_990335801 25 Left 990335794 5:54771360-54771382 CCCTATGCAGGCAGTGTTATTAT No data
Right 990335801 5:54771408-54771430 AGCTCGGTCTCTGGTTTCTCTGG No data
990335794_990335799 16 Left 990335794 5:54771360-54771382 CCCTATGCAGGCAGTGTTATTAT No data
Right 990335799 5:54771399-54771421 CAATCCTGAAGCTCGGTCTCTGG No data
990335794_990335796 9 Left 990335794 5:54771360-54771382 CCCTATGCAGGCAGTGTTATTAT No data
Right 990335796 5:54771392-54771414 CAGCTCCCAATCCTGAAGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990335794 Original CRISPR ATAATAACACTGCCTGCATA GGG (reversed) Intergenic
No off target data available for this crispr