ID: 990335795

View in Genome Browser
Species Human (GRCh38)
Location 5:54771361-54771383
Sequence AATAATAACACTGCCTGCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990335795_990335801 24 Left 990335795 5:54771361-54771383 CCTATGCAGGCAGTGTTATTATT No data
Right 990335801 5:54771408-54771430 AGCTCGGTCTCTGGTTTCTCTGG No data
990335795_990335799 15 Left 990335795 5:54771361-54771383 CCTATGCAGGCAGTGTTATTATT No data
Right 990335799 5:54771399-54771421 CAATCCTGAAGCTCGGTCTCTGG No data
990335795_990335796 8 Left 990335795 5:54771361-54771383 CCTATGCAGGCAGTGTTATTATT No data
Right 990335796 5:54771392-54771414 CAGCTCCCAATCCTGAAGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990335795 Original CRISPR AATAATAACACTGCCTGCAT AGG (reversed) Intergenic
No off target data available for this crispr