ID: 990335796

View in Genome Browser
Species Human (GRCh38)
Location 5:54771392-54771414
Sequence CAGCTCCCAATCCTGAAGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990335795_990335796 8 Left 990335795 5:54771361-54771383 CCTATGCAGGCAGTGTTATTATT No data
Right 990335796 5:54771392-54771414 CAGCTCCCAATCCTGAAGCTCGG No data
990335794_990335796 9 Left 990335794 5:54771360-54771382 CCCTATGCAGGCAGTGTTATTAT No data
Right 990335796 5:54771392-54771414 CAGCTCCCAATCCTGAAGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990335796 Original CRISPR CAGCTCCCAATCCTGAAGCT CGG Intergenic
No off target data available for this crispr