ID: 990336199

View in Genome Browser
Species Human (GRCh38)
Location 5:54775017-54775039
Sequence CCTCCCCAAAGGGGCCATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990336199_990336207 21 Left 990336199 5:54775017-54775039 CCAACATGGCCCCTTTGGGGAGG No data
Right 990336207 5:54775061-54775083 AGAGAAAGCTGTGCAAAGGAAGG No data
990336199_990336209 25 Left 990336199 5:54775017-54775039 CCAACATGGCCCCTTTGGGGAGG No data
Right 990336209 5:54775065-54775087 AAAGCTGTGCAAAGGAAGGGTGG No data
990336199_990336208 22 Left 990336199 5:54775017-54775039 CCAACATGGCCCCTTTGGGGAGG No data
Right 990336208 5:54775062-54775084 GAGAAAGCTGTGCAAAGGAAGGG No data
990336199_990336206 17 Left 990336199 5:54775017-54775039 CCAACATGGCCCCTTTGGGGAGG No data
Right 990336206 5:54775057-54775079 TGAAAGAGAAAGCTGTGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990336199 Original CRISPR CCTCCCCAAAGGGGCCATGT TGG (reversed) Intergenic