ID: 990338281

View in Genome Browser
Species Human (GRCh38)
Location 5:54796366-54796388
Sequence CCCTCCCATCTCTTCCTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990338272_990338281 28 Left 990338272 5:54796315-54796337 CCATGTAGGCCCCTTGAAACCTC No data
Right 990338281 5:54796366-54796388 CCCTCCCATCTCTTCCTTGAGGG No data
990338274_990338281 18 Left 990338274 5:54796325-54796347 CCCTTGAAACCTCTTTTCCTAAG No data
Right 990338281 5:54796366-54796388 CCCTCCCATCTCTTCCTTGAGGG No data
990338275_990338281 17 Left 990338275 5:54796326-54796348 CCTTGAAACCTCTTTTCCTAAGC No data
Right 990338281 5:54796366-54796388 CCCTCCCATCTCTTCCTTGAGGG No data
990338276_990338281 9 Left 990338276 5:54796334-54796356 CCTCTTTTCCTAAGCTTAAGTTA No data
Right 990338281 5:54796366-54796388 CCCTCCCATCTCTTCCTTGAGGG No data
990338277_990338281 1 Left 990338277 5:54796342-54796364 CCTAAGCTTAAGTTAAAGTCCAA No data
Right 990338281 5:54796366-54796388 CCCTCCCATCTCTTCCTTGAGGG No data
990338273_990338281 19 Left 990338273 5:54796324-54796346 CCCCTTGAAACCTCTTTTCCTAA No data
Right 990338281 5:54796366-54796388 CCCTCCCATCTCTTCCTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990338281 Original CRISPR CCCTCCCATCTCTTCCTTGA GGG Intergenic
No off target data available for this crispr