ID: 990339501

View in Genome Browser
Species Human (GRCh38)
Location 5:54808524-54808546
Sequence CAGTGGTGAAGAGCCCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 258}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990339501_990339509 16 Left 990339501 5:54808524-54808546 CCACACTGGGCTCTTCACCACTG 0: 1
1: 0
2: 0
3: 30
4: 258
Right 990339509 5:54808563-54808585 CTGCTTTCTGCCATCTGGTCTGG 0: 1
1: 0
2: 4
3: 23
4: 230
990339501_990339508 11 Left 990339501 5:54808524-54808546 CCACACTGGGCTCTTCACCACTG 0: 1
1: 0
2: 0
3: 30
4: 258
Right 990339508 5:54808558-54808580 GGGATCTGCTTTCTGCCATCTGG 0: 1
1: 0
2: 0
3: 17
4: 181
990339501_990339503 -9 Left 990339501 5:54808524-54808546 CCACACTGGGCTCTTCACCACTG 0: 1
1: 0
2: 0
3: 30
4: 258
Right 990339503 5:54808538-54808560 TCACCACTGTGCTGTCCCCAGGG 0: 1
1: 0
2: 0
3: 27
4: 250
990339501_990339510 17 Left 990339501 5:54808524-54808546 CCACACTGGGCTCTTCACCACTG 0: 1
1: 0
2: 0
3: 30
4: 258
Right 990339510 5:54808564-54808586 TGCTTTCTGCCATCTGGTCTGGG 0: 1
1: 0
2: 3
3: 26
4: 245
990339501_990339502 -10 Left 990339501 5:54808524-54808546 CCACACTGGGCTCTTCACCACTG 0: 1
1: 0
2: 0
3: 30
4: 258
Right 990339502 5:54808537-54808559 TTCACCACTGTGCTGTCCCCAGG 0: 1
1: 0
2: 2
3: 28
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990339501 Original CRISPR CAGTGGTGAAGAGCCCAGTG TGG (reversed) Intergenic
901637809 1:10678442-10678464 GAGTGGGGCAGAGCCCAGGGAGG + Intronic
901731149 1:11280794-11280816 CAGAGGTAAAGAGACCAGTTGGG - Intronic
901775405 1:11557153-11557175 GAGTGGAGAAGAGCCCAGGGAGG - Intergenic
902373281 1:16018247-16018269 CAGTGGTGAGGAGGCCCCTGGGG - Exonic
904268332 1:29331045-29331067 CAGTGGAGATGAGCCCAGCTAGG - Intergenic
904288486 1:29469077-29469099 CAGTGTTGCAGAGCCCAGAGTGG + Intergenic
904383393 1:30126066-30126088 CAGTGGTGAAGGGCAGGGTGGGG + Intergenic
904383938 1:30129615-30129637 CAGTGGGGGAGAGCCTAGTTGGG - Intergenic
906104639 1:43284572-43284594 CAGAGGTGGGGAGCCCAGTTAGG - Intronic
906576765 1:46898279-46898301 CAGTTGAGGAAAGCCCAGTGGGG + Intergenic
906595154 1:47069306-47069328 CAGTTGAGGAAAGCCCAGTGGGG - Intronic
908802665 1:67896627-67896649 CAGTGGTGCAGAGATCAGAGTGG - Intergenic
909604886 1:77498099-77498121 CAGAGGAGAAGAGCACAGGGAGG + Intronic
911449257 1:98044518-98044540 TTGTGGGCAAGAGCCCAGTGGGG + Intergenic
912376250 1:109212248-109212270 CAGTGGTGAGGGGCCCTGGGGGG + Intergenic
912511107 1:110190664-110190686 CTGTGGTGACAAGCCCTGTGTGG - Intronic
913073814 1:115324385-115324407 CTGGGGTGAAGAGCCAATTGAGG - Intronic
915072852 1:153286458-153286480 CAGTGGAGCAGCGCCAAGTGGGG + Intergenic
915593666 1:156884413-156884435 CAGTGGTGCGGAGACCAGTGGGG + Intergenic
915599903 1:156915547-156915569 CAGGGGTGAACAGGCGAGTGGGG - Exonic
915640546 1:157220829-157220851 CAGTAGTCAAGAGACCTGTGAGG - Intergenic
917039321 1:170786559-170786581 CAGTGGGGAATAACCCACTGTGG + Intergenic
918289623 1:183094151-183094173 GAGTGGTGAGGAGGCCAGTGCGG - Intronic
918381728 1:183962713-183962735 CAGGGGTGAAGAGACCACTTTGG - Intronic
920138476 1:203789962-203789984 CAGTGGTGATGAACACTGTGGGG + Intergenic
921412601 1:214851668-214851690 CACAGCTGCAGAGCCCAGTGAGG - Intergenic
921951434 1:220934361-220934383 GAGTTGAGAGGAGCCCAGTGGGG - Intergenic
922885406 1:229016666-229016688 CAGTGGTGGAGAGGGCAGGGAGG - Intergenic
923790314 1:237106040-237106062 CAGTGGTGGGGAGGCCAGAGGGG + Intronic
1062868550 10:878105-878127 CAAGGGTCAAGAGCCCACTGGGG + Intronic
1063517251 10:6709301-6709323 CAGAGGTGAGGAGGCCAATGAGG - Intergenic
1065517353 10:26537507-26537529 CAGTTGTGAGGTGCCCAGTGTGG - Intronic
1066123983 10:32320875-32320897 CAGTGGTCAAAAGCCGGGTGTGG - Intronic
1066532222 10:36353325-36353347 GAGAGGTGAAGATCCTAGTGTGG + Intergenic
1069291141 10:66781156-66781178 CAGTGCAGAGGAGCCCTGTGTGG + Intronic
1070480300 10:76875657-76875679 CAGGAGTGAAGAGCCCACTATGG + Intronic
1073744779 10:106455293-106455315 ACATGGTAAAGAGCCCAGTGTGG - Intergenic
1074441662 10:113482633-113482655 CAATGTTGAAGAACACAGTGGGG - Intergenic
1074506099 10:114072191-114072213 CAGTGGGGCAGAGCTCACTGCGG - Intergenic
1076103170 10:127798509-127798531 CAGAAGTGAAGACCCAAGTGCGG - Intergenic
1076108873 10:127846029-127846051 CAGTGGGGAAGAGCTCAGTTTGG - Intergenic
1076228587 10:128801204-128801226 CAGTGCTGCTGAGCCAAGTGGGG - Intergenic
1077226166 11:1439940-1439962 CAGGAGTCAAGGGCCCAGTGTGG - Intronic
1077497656 11:2894186-2894208 CAGTGGTGAAGATGCCAGCCTGG + Intronic
1081932219 11:46879368-46879390 CAGTGGCAAAGAGCTCACTGTGG + Intronic
1083937469 11:65877552-65877574 CAGAGGTGGAGGTCCCAGTGTGG - Intergenic
1083986840 11:66221131-66221153 CTGTGGTGAAGAGCACAGCCAGG - Intronic
1084218145 11:67662715-67662737 GGGTGGTGCAGAGACCAGTGTGG + Exonic
1084955055 11:72686737-72686759 CAGAGGTGAGCAGGCCAGTGAGG - Intronic
1085042403 11:73334405-73334427 CAGTGGTGAAGAGACCAGCCTGG + Intronic
1085329215 11:75633766-75633788 GAATGCTGAAGAGGCCAGTGAGG + Intronic
1088147613 11:106701483-106701505 AAATGGTGAAGAGAGCAGTGGGG - Intronic
1090392859 11:126400719-126400741 TTGTGGTGAAGAGACCAGTTAGG + Intronic
1092236152 12:6811021-6811043 CAGTGGGGAAGAGGACTGTGTGG + Intronic
1092370735 12:7914940-7914962 AAGTGGTGAAGAACACAGGGAGG - Intergenic
1093893285 12:24548875-24548897 CGGTGATGAAGAACCCATTGAGG - Intergenic
1094088487 12:26621122-26621144 AGGTGGTGAAGAGCCAATTGAGG - Exonic
1094127996 12:27043921-27043943 CATTGGTTAAGAAACCAGTGTGG + Intronic
1095954324 12:47797727-47797749 CGTGGGTGAAGAGCCCACTGGGG + Intronic
1096855052 12:54474930-54474952 CAGTGGTGTAGAGCCCAAATAGG + Intergenic
1099006440 12:77240040-77240062 CAGTGGTGAAGAGCTCAGGCTGG + Intergenic
1102781714 12:115571268-115571290 AAGTGGCAAAGAGGCCAGTGTGG + Intergenic
1103277374 12:119723846-119723868 CAGAGGTTTAGAGCCCAGTATGG + Intronic
1104956406 12:132468519-132468541 CAGGAGTGCACAGCCCAGTGAGG + Intergenic
1105741664 13:23331062-23331084 CAGGGGTGAGGAACTCAGTGGGG + Exonic
1106229362 13:27809867-27809889 CAGTGTGGAAGAGCCATGTGAGG + Intergenic
1108534038 13:51354857-51354879 AGGTGGGGAAGAGCCCTGTGTGG + Intronic
1110626916 13:77662775-77662797 GAGTGCTTAGGAGCCCAGTGAGG + Intergenic
1118327435 14:64791188-64791210 AGGTGGTGAACAGCCCAGGGAGG - Intronic
1119535068 14:75396175-75396197 CAGTGGTTACGAGCCCAGACTGG + Intergenic
1120338716 14:83191385-83191407 CAGTGGGGAGGAGCCCACTTTGG - Intergenic
1120835639 14:89036311-89036333 CATTGGGGAAAAGCCCCGTGGGG - Intergenic
1121091941 14:91188980-91189002 CAGTGGTGATGAGCACTGAGCGG - Exonic
1122268916 14:100559586-100559608 CAGTGGTGAGCAGCCTGGTGGGG - Intronic
1122835589 14:104429330-104429352 CAGTGGTGAGGTGCCCTGGGCGG + Intergenic
1124267544 15:28250307-28250329 TGGTGGTGGTGAGCCCAGTGAGG - Intronic
1126578961 15:50224763-50224785 CAGTGCTGAATAGCCACGTGTGG + Intronic
1127989415 15:64101008-64101030 CAGTAGTTAAGAGACCAGTCTGG - Intronic
1128062958 15:64746863-64746885 CAGAGGTGAGAAGCCCAGTGAGG + Intronic
1130759375 15:86802490-86802512 CAATGCTGGAGAGCCCAATGCGG + Intronic
1132295160 15:100729161-100729183 CAGAGGTGGACAACCCAGTGGGG + Intergenic
1135960911 16:26993815-26993837 CAGTGGTTGAGAGCCAAGTTTGG + Intergenic
1136507155 16:30712010-30712032 CAGGGATGAAGAGCAGAGTGAGG + Exonic
1137425735 16:48378915-48378937 AAGTGCTGAAGAGACCAGTGGGG - Intronic
1137631996 16:49953251-49953273 TGGTGGTGAAGAGCCCAGGCAGG + Intergenic
1138530668 16:57632654-57632676 CTTTGGTGAGGAGGCCAGTGTGG + Intronic
1138857481 16:60712028-60712050 CAGTGTGGATGAGCCCAGGGTGG + Intergenic
1140436509 16:74951286-74951308 TGGTGGTGAAGAGCACAGTGAGG - Intronic
1143676885 17:8440002-8440024 TAGTGGTTAAGAGCCCAGACCGG - Intronic
1144561797 17:16326706-16326728 AAGTGGTGAAGAGCACAGGCTGG + Intronic
1145977276 17:28991602-28991624 CAGTGAGGAAGAGCCCAGGGTGG + Intronic
1145999220 17:29121447-29121469 GAGTGGACAGGAGCCCAGTGGGG + Intronic
1148735059 17:49860611-49860633 CAGTGGTGATGAGCTCAGACTGG - Intergenic
1149188685 17:54031673-54031695 CATTGGTGATGAGCAAAGTGTGG + Intergenic
1151712396 17:75814156-75814178 GAGTGGTGGAAAGCCCAGAGTGG - Intronic
1152281539 17:79387625-79387647 CAGTGGTGAGAACCACAGTGAGG - Intronic
1152371926 17:79893550-79893572 CAGTGATGCAGAGCCCAGGGTGG + Intergenic
1152495257 17:80666731-80666753 TAGTGGTGCAGAGCCTCGTGGGG + Intronic
1155591908 18:27436856-27436878 CAATGGTGAAGAGCCCTGGAGGG - Intergenic
1157546556 18:48550572-48550594 GAGTGGAGAGGAGCCCAGAGGGG - Intronic
1157719150 18:49910217-49910239 AACTGGAGGAGAGCCCAGTGTGG + Intronic
1158819239 18:61139885-61139907 CAGTAGTGAATAGAGCAGTGGGG + Intergenic
1158947409 18:62458983-62459005 GAGCAGTGAAGAGACCAGTGTGG - Intergenic
1159943323 18:74425666-74425688 CCCTGGGGAAGAGCCCAGGGAGG + Intergenic
1160096180 18:75875731-75875753 CAGTGGAGAGGAGCCCCGTGTGG + Intergenic
1160235204 18:77080378-77080400 CCCAGGTGAGGAGCCCAGTGTGG - Intronic
1161104573 19:2436998-2437020 CAGTTGTGAAGGGGCCTGTGGGG - Intronic
1165219164 19:34300761-34300783 CAGTGCTGAAGAGATCTGTGAGG - Exonic
1166636029 19:44452554-44452576 CAGAGGTGAGGAGCACAGGGAGG + Intergenic
1167455254 19:49594455-49594477 CAGTGTCGAAGAGTCCAGAGAGG - Exonic
1167491953 19:49798231-49798253 CAGTGGTGGAGAGCTCTGGGGGG + Intronic
1167841771 19:52127718-52127740 CTGTGGTGAAGAGAGCATTGTGG + Intronic
1168215270 19:54920534-54920556 AAGTGGGTAAGAGCCCAGTGTGG + Intergenic
1168266849 19:55228070-55228092 CAGTGGTCAAAGGCACAGTGGGG - Intronic
1168698400 19:58419604-58419626 GAGAGGTGAACAGCCCAGAGAGG - Intergenic
925295448 2:2773442-2773464 CAGAGGTGGAGCACCCAGTGAGG + Intergenic
926994112 2:18715235-18715257 CAGGGAAGAAAAGCCCAGTGGGG - Intergenic
927765312 2:25801998-25802020 AAGTGGTAAAGATTCCAGTGTGG - Intronic
928442222 2:31302108-31302130 CAGTGTTCAAGTGCCCAGTCTGG + Intergenic
928591169 2:32816835-32816857 CAGTTGTGAAGTCCCCATTGGGG + Intronic
931945371 2:67300350-67300372 AAGTGCTGAAGAGCACTGTGAGG + Intergenic
932131003 2:69187167-69187189 GGGTGGAGAAGAGCCCACTGTGG - Intronic
933648629 2:84831644-84831666 CAGTGGTAAACAGGCCAGAGGGG - Intronic
933885404 2:86715171-86715193 GAGTGGTGAAGGCCACAGTGAGG + Intronic
933924771 2:87081520-87081542 GAGTGGTGAAGGCCACAGTGAGG - Intergenic
935144862 2:100388770-100388792 CACCGGGAAAGAGCCCAGTGGGG + Intergenic
936736142 2:115445917-115445939 CAGTGGTGCACAGAGCAGTGGGG - Intronic
937290254 2:120777704-120777726 CGGGGGTGCAGAGCCTAGTGTGG + Intronic
937290294 2:120777890-120777912 CTGGGGTGCAGAGCCCAGTGTGG + Intronic
939275685 2:139993298-139993320 CAGTGGGGAGGATCCCACTGTGG - Intergenic
944563256 2:200963048-200963070 CAGTGGTAAAGTGCCCTGTGAGG - Intronic
945436560 2:209825155-209825177 GAATGATGCAGAGCCCAGTGTGG - Intronic
946716272 2:222557171-222557193 CAGAGGGAAAGAGGCCAGTGAGG - Intronic
948406320 2:237722755-237722777 GAGTGGTGAAGAGGCCTGCGTGG + Intronic
948966970 2:241390076-241390098 CAAAGGTGAAGGGCACAGTGAGG - Intronic
1168793812 20:597802-597824 TGGTGGTTGAGAGCCCAGTGGGG + Intergenic
1169352809 20:4883168-4883190 CAGGAGTGCAGAGCTCAGTGTGG + Intronic
1170553201 20:17494670-17494692 CTTTGGTGTAGAGCTCAGTGGGG + Exonic
1170596660 20:17810942-17810964 CAGTGGTGCCAAGCCCAGGGGGG + Intergenic
1170778570 20:19402912-19402934 CAGTGCTCAAGAGCCATGTGTGG - Intronic
1170792390 20:19518806-19518828 CAGTTGAGAAGAGCCCAGGCAGG + Intronic
1170857227 20:20068425-20068447 CTGTGCTAAAGAGCCCTGTGTGG + Intronic
1173054615 20:39599012-39599034 ACGTGGTGCAGAGACCAGTGAGG + Intergenic
1173315164 20:41936618-41936640 CAGCTGAGCAGAGCCCAGTGGGG + Intergenic
1173456838 20:43209613-43209635 TAGTGGTCAGGGGCCCAGTGCGG + Intergenic
1175088909 20:56485581-56485603 GAGTGGGGAAGAGGTCAGTGGGG + Intronic
1175466203 20:59192483-59192505 CGGTGGTGGAGAGCTGAGTGGGG - Exonic
1179894917 21:44356284-44356306 CAGTGATGAAGAGCCCCATGTGG + Intronic
1180002795 21:45002690-45002712 CACTGGAGTAGAGCCCTGTGAGG + Intergenic
1180145242 21:45915086-45915108 CTGTGGAGACGAGGCCAGTGTGG - Intronic
1180195356 21:46190586-46190608 CATCCGTGAATAGCCCAGTGCGG - Exonic
1180699980 22:17775966-17775988 CAGTGGGCAAGAGGCCAGTGGGG + Intergenic
1181174507 22:21028076-21028098 CAGCCATGAAGAGACCAGTGGGG + Exonic
1182704887 22:32270913-32270935 CAGTGGTGAACATGCCACTGAGG - Intergenic
1182719197 22:32384094-32384116 GAGTGGTCAGAAGCCCAGTGGGG + Intergenic
1183457812 22:37932388-37932410 CAGTGGGGAAGGGGCCAGTGTGG - Intronic
1183965790 22:41441486-41441508 AAGTTGTGAAGAGCCAGGTGTGG + Intronic
1184500830 22:44870541-44870563 CATTGGACAAGAGACCAGTGGGG - Intergenic
1184873801 22:47259627-47259649 GAGTGGTCAAGAGCTCAGAGAGG - Intergenic
950577330 3:13840091-13840113 CAGAGGCAAAGAGGCCAGTGTGG - Intronic
951593217 3:24289075-24289097 AAATGGACAAGAGCCCAGTGTGG + Intronic
952946572 3:38481688-38481710 TAGTGGTCAAAACCCCAGTGGGG - Intronic
954370536 3:50167619-50167641 CAGGGGTAAAGAGCCCAGCTGGG - Intronic
954800983 3:53186710-53186732 TGGTGGGGAAGGGCCCAGTGTGG + Intronic
955932117 3:64067613-64067635 CAGTGGTTAATGGGCCAGTGAGG + Intergenic
956059212 3:65332880-65332902 CTGTAATGAAGAGGCCAGTGGGG + Intergenic
957892848 3:86382325-86382347 CAGTGGGTAAGAACCCAGTTTGG - Intergenic
959917956 3:111839166-111839188 CAGTCTGGAAGAGCTCAGTGTGG - Intronic
960522939 3:118676892-118676914 CAGTGATGGAGATCCAAGTGTGG + Intergenic
961528792 3:127526790-127526812 GAGCGGTGAAGAGGGCAGTGTGG + Intergenic
962381692 3:134903396-134903418 CACTGCTGAAGAGGCCAGAGAGG - Intronic
963989767 3:151639697-151639719 CAGTGGTAAAGGGCTCAGTAAGG + Intergenic
964700559 3:159561326-159561348 CAGTGGAGGAAAACCCAGTGGGG - Intronic
966822711 3:183937660-183937682 CAGTGCTGAAGAGGCCAGAGAGG - Intronic
967892775 3:194374972-194374994 GGGTGGAGGAGAGCCCAGTGTGG - Intergenic
967990310 3:195125517-195125539 CAATGGGGAAGAGCCCAGGAAGG + Intronic
968190044 3:196660894-196660916 CATTGGCGAAGAGGCCAGGGGGG - Exonic
969418504 4:7076265-7076287 CAGTGGGGCAGCGCACAGTGAGG - Intergenic
969423515 4:7110730-7110752 CAGTGGTGCCCAGCCCAGAGTGG - Intergenic
969574652 4:8029930-8029952 CAGGTCTGAAGAGCCGAGTGGGG + Intronic
969690959 4:8703945-8703967 CTGTGGGGAAGTCCCCAGTGAGG + Intergenic
970138884 4:12958154-12958176 GAGCAGTGAAGAGCTCAGTGAGG - Intergenic
970227518 4:13875022-13875044 CAGTGGGAAAGAGCACAGTCTGG + Intergenic
972394513 4:38647294-38647316 AAGTGATGCAGAGACCAGTGTGG - Intergenic
978015224 4:103735948-103735970 CAGTGGTGATGAGATAAGTGGGG + Intergenic
979682932 4:123481347-123481369 CCTTGGAGAAGAGGCCAGTGTGG + Intergenic
980499200 4:133626995-133627017 CAGTAGAGATGTGCCCAGTGAGG - Intergenic
981526486 4:145711237-145711259 CACTGGAGAAGAGTGCAGTGGGG - Intronic
983527801 4:168777950-168777972 CAGTCCTGAAGAACCCAGAGGGG + Intronic
985128224 4:186716286-186716308 GAGTGGAGAAGAGCACAGTGAGG - Intronic
985401028 4:189594272-189594294 CCGTGGTGTAAAACCCAGTGTGG + Intergenic
985553685 5:545873-545895 CAGTGGTCAGGGGCCCACTGTGG - Intergenic
989335904 5:40316475-40316497 CAGGGGTTTAAAGCCCAGTGTGG - Intergenic
989704333 5:44310289-44310311 CAGTGGTGACTAACCCACTGTGG + Intronic
990339501 5:54808524-54808546 CAGTGGTGAAGAGCCCAGTGTGG - Intergenic
990446506 5:55898215-55898237 CAGTGGCGAAGGGCCAAGTAGGG + Intronic
991363013 5:65840719-65840741 CTATGGTGAAGAACTCAGTGGGG - Intronic
991682118 5:69150035-69150057 CAGTGGGGAAGAGCACTGAGTGG - Intergenic
994005920 5:94837075-94837097 CAGTGGTTAAGAACACAGGGAGG + Intronic
994310070 5:98259281-98259303 CAGTGGGGTAGAGCCCGGAGTGG - Intergenic
996457699 5:123703712-123703734 CAGTGGGGAAGAGATCAATGTGG - Intergenic
998178627 5:139918903-139918925 CAGTGGTGGAGAGGCCAGGAGGG + Intronic
998720923 5:144947916-144947938 CAGGGGTGAATATCTCAGTGAGG + Intergenic
999363956 5:151009213-151009235 CACTGGACAATAGCCCAGTGAGG + Intergenic
1001175329 5:169463338-169463360 TTGTGGGGAAGAGCCCAGAGTGG - Intergenic
1001285367 5:170419219-170419241 CAGAGGCCAAGACCCCAGTGAGG + Intronic
1001448912 5:171809102-171809124 CAGTGACTCAGAGCCCAGTGAGG - Intergenic
1002480539 5:179498055-179498077 CAGTGGAGCCGAGCCCAGAGAGG - Intergenic
1002822033 6:734817-734839 CAGTGGTGAACAGCATAGTAGGG + Intergenic
1003730385 6:8815784-8815806 CAGTTGAGAAGAAGCCAGTGTGG + Intergenic
1004338443 6:14785319-14785341 CAGTGGTGAAGAGCCTGGAATGG + Intergenic
1004339465 6:14795526-14795548 GAGTTGTGCAGAGGCCAGTGAGG - Intergenic
1004851908 6:19708067-19708089 CAGTGGGGAAAAGGCCAGTAAGG + Intergenic
1006957451 6:37886574-37886596 CAGTGCTGAAGAGACCAATGTGG - Intronic
1008439437 6:51515843-51515865 CATTGGAGATGAGGCCAGTGTGG - Intergenic
1008773106 6:55003349-55003371 CAGTGGTGGCCAGCACAGTGAGG - Intergenic
1012616412 6:101284035-101284057 CAGTGCTGGAGACCCCAGTTAGG - Intergenic
1014350787 6:120342588-120342610 CTGTTGTGAACAGCACAGTGAGG + Intergenic
1015637886 6:135296912-135296934 CATTGTGGAAGTGCCCAGTGTGG - Intronic
1015840499 6:137471711-137471733 CGGTGGGGAAGAGCTGAGTGTGG - Intergenic
1016721908 6:147308123-147308145 CAGGGATGAAGGGACCAGTGGGG - Intronic
1017565049 6:155674847-155674869 CTCTGGTGAAGAGTTCAGTGGGG + Intergenic
1018003227 6:159597751-159597773 CAGCGATGCAGAGCCCAGAGAGG + Intergenic
1018338704 6:162825833-162825855 CAGTGAGCAGGAGCCCAGTGAGG - Intronic
1018418302 6:163620421-163620443 CAGTGGTGGACAGGCCAGCGAGG - Intergenic
1018682339 6:166275051-166275073 CACAAGTGAAGGGCCCAGTGGGG - Intergenic
1018963682 6:168466846-168466868 GAATGGTGAATAGCCCGGTGGGG + Intronic
1019173104 6:170145959-170145981 CAGTGGTGATAAGCACACTGCGG + Intergenic
1019622109 7:1997686-1997708 CAGGGCTGCACAGCCCAGTGCGG + Intronic
1020144022 7:5628986-5629008 CAGGAGTTAAGAGACCAGTGTGG + Intronic
1021039552 7:15845089-15845111 CAGTGGGAAAGAGCACAGAGTGG - Intergenic
1022165957 7:27762485-27762507 CAGGAGTTAAGAGACCAGTGTGG + Intronic
1022593215 7:31686287-31686309 CACTGGAGGAGAGCCCACTGGGG - Intergenic
1022923081 7:35036238-35036260 CAGTAGCGAAAAGCCCACTGAGG + Intronic
1023069250 7:36412747-36412769 CAGTGGGGAGGAGCCAGGTGAGG - Intronic
1023949421 7:44830505-44830527 CATTTGGGAAGAGTCCAGTGGGG - Intronic
1026674204 7:72415759-72415781 CAGTGGGGCAGAGGCCCGTGAGG + Intronic
1026960440 7:74404303-74404325 CAGTCTTTAAGAGCCAAGTGGGG + Exonic
1029857934 7:103537704-103537726 TAGTGGAGAAGAGTACAGTGTGG - Intronic
1029950994 7:104585360-104585382 GAATGCTGAAGAGCCCTGTGCGG - Intronic
1030573948 7:111262975-111262997 CAGAGAGGAAGAGCCCAGTGTGG + Intronic
1033231704 7:139603332-139603354 CACTGGTGAAGGGGCCATTGTGG + Intronic
1033888797 7:145981988-145982010 CAGTGGTGAAAATCCAAGTTGGG + Intergenic
1035040137 7:155921122-155921144 CTGAGGTGTAGAGCTCAGTGAGG - Intergenic
1035216582 7:157372232-157372254 CCCTGGTGAAGAGAACAGTGAGG + Intronic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1036821050 8:11940375-11940397 AAGTGATGAAGAGCCAGGTGTGG + Intergenic
1037690850 8:21180240-21180262 CAGTGGTGTTGAACCCAGTGTGG - Intergenic
1038427297 8:27472090-27472112 GAGGGGTGATGAGCCCAGCGAGG + Intronic
1040691937 8:49949178-49949200 GGTTGGTGAAGAGACCAGTGGGG + Intronic
1040724339 8:50363551-50363573 CAGTTGTGAAGTGACTAGTGAGG + Intronic
1041056989 8:53996326-53996348 CAGTGGTGAATAGCCAAGCTGGG - Intronic
1041394348 8:57376023-57376045 AAGAGGTGAAGAACCCCGTGGGG - Intergenic
1043514953 8:80987321-80987343 CAGAGGTGATGAGGCCTGTGTGG + Intronic
1044071200 8:87762442-87762464 TGATGGTGAGGAGCCCAGTGGGG + Intergenic
1045049058 8:98306457-98306479 CACTCGTGAAGAACCCAGAGAGG - Intergenic
1047223710 8:122939315-122939337 CAGAGGTGAAGAGCTCAGTCAGG - Intronic
1047537521 8:125733252-125733274 CAGTGGCGAACAGCTCCGTGTGG - Intergenic
1047675646 8:127198494-127198516 GAGTGGTAAGGAGGCCAGTGTGG + Intergenic
1049094279 8:140539334-140539356 CAGTGCAGAAGAGCCGGGTGTGG + Exonic
1049165960 8:141126718-141126740 CAGTGGTCAAGATCCAAGGGAGG - Intronic
1049463922 8:142742498-142742520 ACGTGGTAAAGGGCCCAGTGGGG + Intergenic
1049812046 8:144579977-144579999 CAGTGGGGAAGAGCCGAGGCAGG - Intronic
1053346430 9:37381911-37381933 CAGAGGTGAGGACTCCAGTGGGG + Intergenic
1054708100 9:68483481-68483503 CACTGGAGAAGAGACCAGTGTGG + Intronic
1055789615 9:79909846-79909868 AAGTGGGGAAGAGCACTGTGAGG + Intergenic
1056458798 9:86789360-86789382 TAGGTGTGAAGGGCCCAGTGAGG + Intergenic
1056575317 9:87851864-87851886 CAGGGATGAAATGCCCAGTGAGG - Intergenic
1057097001 9:92320215-92320237 CAGAGGCAAAGAGGCCAGTGAGG - Intronic
1057516425 9:95725660-95725682 GAGTCGTGAAGAGCCCAGCGGGG + Intergenic
1057546481 9:96022804-96022826 CGGGGCTGAAGAGCCAAGTGTGG - Intergenic
1057907789 9:98995526-98995548 CAGTGGAACAGAGCCCAGGGAGG - Intronic
1058150931 9:101462681-101462703 CAGTGGATAAAAGCACAGTGGGG + Intergenic
1058827086 9:108784745-108784767 CAGATCTGAAAAGCCCAGTGTGG + Intergenic
1059539075 9:115112789-115112811 CAGTGGTGTACAGTCCAGTGTGG + Intronic
1060745755 9:126129803-126129825 AGGTGGTGAGGACCCCAGTGAGG + Intergenic
1060833642 9:126738483-126738505 TTGGTGTGAAGAGCCCAGTGTGG + Intergenic
1061076697 9:128345642-128345664 CAGTGGTTAAGGGCACAGAGTGG + Intronic
1061569431 9:131467651-131467673 CAGTGAGGAAGAGGCCAGAGAGG + Exonic
1061584229 9:131555762-131555784 GAGGGGTGGCGAGCCCAGTGAGG + Intergenic
1062710034 9:137970460-137970482 CAGTGGTGAAGAAGACAATGTGG + Intronic
1186062410 X:5724001-5724023 CAGTTGTCAACAGCCAAGTGTGG - Intergenic
1186704864 X:12130249-12130271 CAGTGGGGTAGAGGCCAGAGAGG - Intergenic
1187388855 X:18872803-18872825 CGGTGGGGCAGAGCCCAGTCAGG + Intergenic
1189196097 X:39154114-39154136 CAGTGGAGATTAGCTCAGTGAGG + Intergenic
1189227669 X:39426981-39427003 CTGTGGGGAAGGGCCCTGTGGGG + Intergenic
1189236115 X:39488664-39488686 AAGGGGTGAAGTGCCCAGGGAGG + Intergenic
1189240945 X:39523873-39523895 CAGTGGTGTAGATTCCAGTGTGG + Intergenic
1200051456 X:153434019-153434041 CAGGGGTGGAGCGCCCAGGGTGG + Intergenic