ID: 990342296

View in Genome Browser
Species Human (GRCh38)
Location 5:54835383-54835405
Sequence CTATGGATATAGATTTAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990342296_990342299 -4 Left 990342296 5:54835383-54835405 CCTACCTAAATCTATATCCATAG No data
Right 990342299 5:54835402-54835424 ATAGAATAACTGCCTAATAAAGG No data
990342296_990342300 -3 Left 990342296 5:54835383-54835405 CCTACCTAAATCTATATCCATAG No data
Right 990342300 5:54835403-54835425 TAGAATAACTGCCTAATAAAGGG No data
990342296_990342303 12 Left 990342296 5:54835383-54835405 CCTACCTAAATCTATATCCATAG No data
Right 990342303 5:54835418-54835440 ATAAAGGGTATGGTCATAAGAGG No data
990342296_990342301 2 Left 990342296 5:54835383-54835405 CCTACCTAAATCTATATCCATAG No data
Right 990342301 5:54835408-54835430 TAACTGCCTAATAAAGGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990342296 Original CRISPR CTATGGATATAGATTTAGGT AGG (reversed) Intergenic
No off target data available for this crispr